ID: 981111056

View in Genome Browser
Species Human (GRCh38)
Location 4:140933919-140933941
Sequence GCAGAATTGTCCCCACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981111056_981111059 -1 Left 981111056 4:140933919-140933941 CCACACTGTGGGGACAATTCTGC 0: 1
1: 1
2: 0
3: 9
4: 140
Right 981111059 4:140933941-140933963 CTAATGGGCTTGATCTGAAATGG 0: 1
1: 0
2: 1
3: 14
4: 121
981111056_981111061 4 Left 981111056 4:140933919-140933941 CCACACTGTGGGGACAATTCTGC 0: 1
1: 1
2: 0
3: 9
4: 140
Right 981111061 4:140933946-140933968 GGGCTTGATCTGAAATGGTTGGG No data
981111056_981111060 3 Left 981111056 4:140933919-140933941 CCACACTGTGGGGACAATTCTGC 0: 1
1: 1
2: 0
3: 9
4: 140
Right 981111060 4:140933945-140933967 TGGGCTTGATCTGAAATGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981111056 Original CRISPR GCAGAATTGTCCCCACAGTG TGG (reversed) Intronic
900771038 1:4545011-4545033 CCAGAATGCTGCCCACAGTGAGG + Intergenic
902916616 1:19643855-19643877 GCAGACTTGCCCCGAGAGTGGGG - Intronic
902924979 1:19690068-19690090 GCAGGAAAGTCCCCACAATGTGG - Intronic
903540502 1:24093666-24093688 GAAGAGCTGGCCCCACAGTGTGG - Intronic
915458815 1:156057517-156057539 GCAGATTTGACCCCACAGTTAGG - Intronic
918078531 1:181188800-181188822 TGAGAATTGACCCCAGAGTGAGG - Intergenic
918344080 1:183591056-183591078 GCAGGAAAGTCCCCCCAGTGCGG - Intronic
919829749 1:201532017-201532039 GCACATCTGTACCCACAGTGAGG + Intergenic
921943825 1:220872430-220872452 GCAGATTTCTCTCCCCAGTGTGG - Intergenic
922672167 1:227518818-227518840 GCATAAATGTCACCTCAGTGAGG - Intergenic
924139008 1:241002475-241002497 GCAAAAATGTCTTCACAGTGTGG - Intronic
924822110 1:247503438-247503460 GCATAAATGTCACCTCAGTGAGG - Intergenic
1062803144 10:394932-394954 GCTGAATAGTGCCCACTGTGTGG - Intronic
1063537695 10:6901056-6901078 GCAGGAAAGTCCCCCCAGTGTGG + Intergenic
1064819516 10:19310146-19310168 GCAAAATAGTCCCAACTGTGAGG - Intronic
1065453568 10:25883215-25883237 TCAGAATTGTCCCCACTGGGTGG - Intergenic
1069669582 10:70190375-70190397 GCAGACTTGTCACCGTAGTGCGG - Intergenic
1069766968 10:70869535-70869557 TCAGAAGTGATCCCACAGTGAGG - Intronic
1072411049 10:95202295-95202317 CCTGAATTCTTCCCACAGTGTGG + Intronic
1074344151 10:112665281-112665303 GAAGAGTGGGCCCCACAGTGGGG + Intronic
1075730408 10:124632163-124632185 GCAGAAACGTCGCCACCGTGTGG - Intronic
1078054089 11:7992968-7992990 GGAGACTTGTGTCCACAGTGAGG - Exonic
1079373815 11:19873909-19873931 GCAGCATTGTCCCTGCAGTTGGG - Intronic
1090463946 11:126916450-126916472 TCTGAGTTGTCCTCACAGTGTGG - Intronic
1091756733 12:3058036-3058058 GCAGAATTAGCCTCACAGTTGGG + Intergenic
1092529345 12:9331734-9331756 GCATAAATGTCACCTCAGTGAGG - Intergenic
1094002725 12:25713271-25713293 GCAGATTTCTCTCCCCAGTGTGG + Intergenic
1094812441 12:34151641-34151663 GCATAAATGTCACCTCAGTGAGG + Intergenic
1097684403 12:62677978-62678000 GCACAATTGTCACCACAGCCTGG - Intronic
1105204266 13:18207031-18207053 GGAGACTTGTGTCCACAGTGAGG + Intergenic
1106224558 13:27775150-27775172 GCAGCATTGTCCCCACTTTATGG - Intergenic
1111097912 13:83538810-83538832 GGAGATTTCTCCCAACAGTGTGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1115820796 14:37210657-37210679 GCTGAATTGGCCTCTCAGTGGGG + Intronic
1117503063 14:56373846-56373868 GAAGAAGGGTCCCCCCAGTGTGG - Intergenic
1118345535 14:64938107-64938129 GCAAAACTGTCCTCACAGTGAGG + Intronic
1122849829 14:104522088-104522110 GCACAATTGGCCCCTCAGTGTGG - Intronic
1127917539 15:63467507-63467529 GCACAATTTTCCCCACGGTCGGG - Intergenic
1131456867 15:92588446-92588468 GCAGAAATGTCCACCCATTGGGG + Intergenic
1134207930 16:12252826-12252848 GCAGCACGGTGCCCACAGTGAGG + Intronic
1134518732 16:14907883-14907905 ACAGGATCGTCCCCACCGTGGGG - Intronic
1134555196 16:15158333-15158355 ACAGGATCGTCCCCACCGTGGGG + Intergenic
1134706403 16:16306536-16306558 ACAGGATCGTCCCCACCGTGGGG - Intergenic
1134961137 16:18405574-18405596 ACAGGATCGTCCCCACCGTGGGG + Intergenic
1134965439 16:18488177-18488199 ACAGGATCGTCCCCACCGTGGGG + Intronic
1141369456 16:83473665-83473687 CCAGAATTCTCCCTACAGAGTGG - Intronic
1141441341 16:84031575-84031597 GCAGACTTGTCCCCACAGTGTGG - Intronic
1141618877 16:85226019-85226041 GCTGAAATGTCCCCACATTAGGG + Intergenic
1141678660 16:85531209-85531231 TCAGAGCTGTGCCCACAGTGGGG - Intergenic
1144709559 17:17392454-17392476 GTAGAATTCTCTCCAGAGTGTGG + Intergenic
1150583521 17:66497149-66497171 TCAGAATTGTCCACAAAGAGAGG - Intronic
1152573604 17:81130861-81130883 GCACCTTTGGCCCCACAGTGCGG + Intronic
1152640662 17:81447945-81447967 GCTCAGTTGTCCCCAAAGTGTGG + Intronic
1155929844 18:31695366-31695388 GGAATATTGTCCCCACAGTCAGG + Intergenic
1156830328 18:41484032-41484054 GCAGAATTCTCTGCACAGCGGGG - Intergenic
1157975480 18:52322541-52322563 ACAGAATTGGCCCCAGAGTCTGG - Intergenic
1160050436 18:75428402-75428424 GCAGCGTTATCCCCATAGTGTGG + Intergenic
1160071584 18:75633673-75633695 GTAGGATTGTCCCCACATTGAGG + Intergenic
1160332414 18:78006693-78006715 GAGGGATTGTCCCCACAGTCAGG + Intergenic
1161479575 19:4503812-4503834 GCAGCTTTGTCCCCACCGTGAGG + Exonic
1163287217 19:16356211-16356233 GCAGAATTGTCTGCGCCGTGGGG - Intronic
1163529080 19:17839183-17839205 TCAGAATTGTCCCATCAGAGGGG + Intronic
1164988518 19:32667261-32667283 GCAAAATTGTGCTCACATTGTGG - Intronic
1165438210 19:35808441-35808463 GCAGCATTCTCCCCACCATGCGG - Intronic
925575525 2:5356160-5356182 GCCAAAGTGTCCCCACAGTGTGG + Intergenic
928429172 2:31203736-31203758 GCAGAATTTTACACACAGTAGGG + Intronic
929396922 2:41534031-41534053 GGAGAATTGTACCCCAAGTGTGG + Intergenic
930049088 2:47200087-47200109 GCAAATTTGTCTGCACAGTGAGG - Intergenic
931036731 2:58252048-58252070 GGAGACTTGTGTCCACAGTGAGG - Intergenic
935466709 2:103406669-103406691 TCAGCATTATCCACACAGTGAGG + Intergenic
935860247 2:107321487-107321509 TCAGGAGTGGCCCCACAGTGAGG + Intergenic
935869276 2:107427432-107427454 GCTGAATTGTATCCACAGCGTGG + Intergenic
936516237 2:113183147-113183169 CCAGACTCTTCCCCACAGTGGGG + Exonic
941293464 2:163705223-163705245 GGAGAGTGGTCCCCACACTGTGG - Intronic
943484854 2:188466014-188466036 TCTCAATTGTCCCCCCAGTGAGG - Intronic
945576187 2:211532119-211532141 GAAGAATTGTCACCAGAGTCTGG + Intronic
946444750 2:219728664-219728686 GGAGAAGTGTCCCCACAGGGTGG - Intergenic
1169798652 20:9493092-9493114 TCAGAATTGTCCCACCAGGGTGG + Intergenic
1171414051 20:24965569-24965591 GAGGAGGTGTCCCCACAGTGAGG + Intronic
1172920071 20:38473421-38473443 GCAGCATCGTCCCCACTGGGCGG - Intronic
1175784001 20:61700714-61700736 ACAGACATGGCCCCACAGTGAGG - Intronic
1176713711 21:10331054-10331076 GGAGACTTGTGTCCACAGTGAGG - Intergenic
1177708404 21:24738754-24738776 GCAGAATTCTTCCCAATGTGAGG - Intergenic
1179044169 21:37830171-37830193 TCTGAATTGTCTCCACAGTCAGG + Intronic
1179218623 21:39387817-39387839 GGAGAGTTGTCCCTACTGTGCGG + Intronic
1179709563 21:43205422-43205444 GTAGAATTGTTCCCACTGAGTGG + Intergenic
1179791664 21:43759480-43759502 TCAGAGGTGTCCCCACTGTGTGG + Exonic
1179961404 21:44768935-44768957 GCAGAAAAGCCCCCACCGTGAGG + Exonic
1183553609 22:38507725-38507747 GGAGATTTGGCCCCTCAGTGTGG + Intergenic
949399767 3:3653820-3653842 GCATAATGGTCCCCACAGAAGGG + Intergenic
951757863 3:26112054-26112076 AAAGAATTGTTCCCTCAGTGAGG + Intergenic
955698436 3:61659444-61659466 GCAGGTTTGTCCAGACAGTGGGG + Intronic
956255151 3:67275590-67275612 TCAGAATTGTCCCCACTGATAGG + Intergenic
958412824 3:93838228-93838250 CCACAACTGTCCCCAGAGTGTGG - Intergenic
961647407 3:128400041-128400063 GCAGAAGTGTCCCTAATGTGGGG - Intronic
965634530 3:170767791-170767813 GCAGAATTATCTCCACTTTGTGG + Intronic
966664161 3:182451692-182451714 GCAGAATCCTGCACACAGTGGGG + Intergenic
967605027 3:191434474-191434496 GCAGAATGGTCCTCTCTGTGTGG + Intergenic
968689949 4:1985283-1985305 CCTGAAGTGACCCCACAGTGTGG + Intronic
970158359 4:13164221-13164243 TCAGTATTGTCACCAAAGTGGGG + Intergenic
971549088 4:27926662-27926684 CCAGAAATGTCTCCACATTGAGG + Intergenic
971556050 4:28014072-28014094 GGATAATTGCCTCCACAGTGGGG + Intergenic
973770003 4:54197643-54197665 GCACAGTTTTCTCCACAGTGGGG + Intronic
975013917 4:69387317-69387339 GCAGCATTGTGTCAACAGTGAGG - Intronic
975015173 4:69406668-69406690 GCAGCATTGTGTCAACAGTGAGG - Intronic
979422002 4:120515867-120515889 GCAGAAGATTCCCCACAGAGTGG - Intergenic
979494315 4:121367233-121367255 GCAACATTGTGCCCACAGTCTGG + Intronic
980253018 4:130342322-130342344 GCCTAAATGCCCCCACAGTGGGG - Intergenic
981111056 4:140933919-140933941 GCAGAATTGTCCCCACAGTGTGG - Intronic
982447881 4:155515214-155515236 CCAGAATTTTCCTTACAGTGAGG - Intergenic
985658781 5:1145314-1145336 GCAGCTGTGTCCCCACAGGGAGG - Intergenic
988691789 5:33579917-33579939 ACAGAATTGTCTCAACAGGGAGG + Intronic
989193382 5:38692624-38692646 GAAGCATTGTCGTCACAGTGTGG + Intergenic
994673195 5:102787434-102787456 GCAGTTTTGTCCCCACAGTTGGG - Intronic
1000325596 5:160169754-160169776 AAAGAATTGTCACTACAGTGAGG + Intergenic
1001109471 5:168883709-168883731 GCGGCGTTGACCCCACAGTGGGG - Intronic
1001567239 5:172707474-172707496 GAAGAAGTTTCCCCACACTGGGG - Intergenic
1001593375 5:172881638-172881660 CCTGATTTGTCCCCACACTGTGG + Intronic
1001596305 5:172901087-172901109 GCAGGTTTGTGGCCACAGTGGGG + Intronic
1004126921 6:12883063-12883085 GCAGCATGGTCCCCACAGGTAGG + Intronic
1006134642 6:31888164-31888186 GAAGCATCCTCCCCACAGTGGGG + Exonic
1006361210 6:33588368-33588390 GCAGCTCTGTCCCCAAAGTGAGG - Intergenic
1007732694 6:43958498-43958520 CCTGAATTGTCCCAGCAGTGGGG + Intergenic
1011309409 6:85965741-85965763 GAAGAAATGTGCCCAAAGTGAGG + Intergenic
1019356958 7:585377-585399 GCTGAATCGTACCCACCGTGCGG - Intronic
1019430444 7:996591-996613 ACAGACTTGGCCTCACAGTGGGG + Intergenic
1020902586 7:14024543-14024565 GCAGAATTCTCAGCACAGTTTGG + Intergenic
1032092840 7:128920244-128920266 CCAGCAGTGTCCCCACAGAGGGG - Intergenic
1032705011 7:134414085-134414107 GCAGATTTGTTCCCACAGCCTGG - Intergenic
1035941786 8:3909505-3909527 GCAGGAATGTTCCCACAGCGTGG + Intronic
1036660849 8:10707524-10707546 TCAGAATTGTACCCCTAGTGGGG - Intronic
1041024256 8:53667803-53667825 GCAGAATGGTCCCCAGAGGTGGG + Intergenic
1042575905 8:70218381-70218403 CCAAAATTGTGACCACAGTGTGG - Intronic
1044170092 8:89040328-89040350 GCAGAATTGTATCCAGAGTTTGG - Intergenic
1047248829 8:123166574-123166596 GCTCCATTGTCCCCACACTGTGG + Intergenic
1047581755 8:126223652-126223674 GCAGAGAAGTCCCCACAATGTGG + Intergenic
1049571001 8:143370293-143370315 CCAGAAATGACCCCACAGTCAGG + Intronic
1049753315 8:144296140-144296162 GCAGAGTGGTCCCTGCAGTGAGG + Intronic
1049770007 8:144375365-144375387 ACATAATTGTCCCCAAAGTTAGG - Intronic
1051080165 9:13284806-13284828 GAATAATGCTCCCCACAGTGTGG - Intergenic
1052833139 9:33231651-33231673 GCAGAGTTATCCCCACTGAGAGG - Intronic
1054764996 9:69035873-69035895 GCAGAGTTGGCCCCACTCTGCGG + Exonic
1057279449 9:93699385-93699407 GCAGCCTTGACCCCACCGTGGGG + Intergenic
1061336343 9:129939715-129939737 GTAGAAGTATCCCCCCAGTGAGG - Intronic
1062116097 9:134809808-134809830 TCAGAAATGTCCCCAGAGAGGGG - Intronic
1062539158 9:137034092-137034114 GCAGCCTTGTCCTCACTGTGGGG - Intronic
1186046353 X:5541119-5541141 GGGAATTTGTCCCCACAGTGGGG - Intergenic
1186435869 X:9542906-9542928 GAAGAATTGGCCTCGCAGTGGGG + Intronic
1194275673 X:91878029-91878051 GCAGAATTGTCTCCATAATCAGG - Exonic
1198473829 X:136976415-136976437 GCCCAAGTGTCCCCACAGTCAGG - Intergenic
1200592919 Y:5099463-5099485 GCAGAATTGTCTCCATAATCAGG - Exonic