ID: 981114473

View in Genome Browser
Species Human (GRCh38)
Location 4:140973940-140973962
Sequence TGACACCATCAGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981114473_981114477 17 Left 981114473 4:140973940-140973962 CCCAGCTTCCTCTGATGGTGTCA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 981114477 4:140973980-140974002 GCATTATCAAAACAGGAAATTGG 0: 1
1: 0
2: 2
3: 29
4: 347
981114473_981114476 10 Left 981114473 4:140973940-140973962 CCCAGCTTCCTCTGATGGTGTCA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 981114476 4:140973973-140973995 TTATAGTGCATTATCAAAACAGG 0: 1
1: 1
2: 3
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981114473 Original CRISPR TGACACCATCAGAGGAAGCT GGG (reversed) Intronic
901965793 1:12864649-12864671 TGACACCAACACTGAAAGCTTGG - Intronic
901981193 1:13035026-13035048 TGACACCAACACTGAAAGCTTGG - Intronic
902000893 1:13193903-13193925 TGACACCAACACTGAAAGCTTGG + Intergenic
902020126 1:13339607-13339629 TGACACCAACACTGAAAGCTTGG + Intergenic
904321677 1:29701851-29701873 TAACACCATCAGATGGACCTGGG - Intergenic
904484354 1:30814976-30814998 GGAAACCATCAGAGGGTGCTAGG - Intergenic
904895176 1:33811953-33811975 TGGCCCCATCAGAGGAAACTAGG - Intronic
905127263 1:35724435-35724457 TGACACCATCCCAAGGAGCTTGG + Intronic
905414505 1:37794794-37794816 TGACAGGACCAGAGGGAGCTGGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906816169 1:48881872-48881894 TCTCACCCTCAGAGAAAGCTAGG + Intronic
907188729 1:52632002-52632024 GGGCACCATCTGAGGAAGCAGGG - Intergenic
907298942 1:53473633-53473655 TGTCACCATCGGGGGGAGCTGGG - Intergenic
909009795 1:70321614-70321636 TGTCTCGATCAGAGAAAGCTAGG + Intronic
909110423 1:71469627-71469649 TAATACCATCAGAGATAGCTTGG + Intronic
909447254 1:75760850-75760872 TGTTAACATTAGAGGAAGCTGGG + Intronic
911737059 1:101349175-101349197 TGACACCTTCAGGGAGAGCTAGG + Intergenic
911845480 1:102746749-102746771 TGTTACCATCAGAGGAATCCTGG - Intergenic
912067064 1:105757263-105757285 TGAGACCATCAGTGCAGGCTGGG - Intergenic
916584649 1:166139945-166139967 TACCACCACCAGAGGAACCTTGG + Intronic
920396589 1:205650705-205650727 TGCCATCATCAGGGGATGCTAGG + Intergenic
920518843 1:206607901-206607923 GGCTACCATTAGAGGAAGCTGGG + Intronic
921385358 1:214563379-214563401 AGACGCAATCAGAGGAATCTAGG + Intergenic
921677353 1:217990989-217991011 GGCCACCATCAGAGGATGCCTGG - Intergenic
1062889711 10:1049049-1049071 TGGCACCACCAGGCGAAGCTTGG - Exonic
1065333866 10:24634540-24634562 TGACACCTTCAGATGAAGCCAGG + Intronic
1066657320 10:37708372-37708394 TGCCACAAGCAGAGGAAGGTTGG + Intergenic
1070711580 10:78686942-78686964 GGACACCACCAGAGGCAACTCGG + Intergenic
1070780700 10:79135958-79135980 GTACACAATCAGGGGAAGCTGGG + Intronic
1070889786 10:79934617-79934639 GGACACCATGAGAGCAGGCTGGG - Intergenic
1070970421 10:80561632-80561654 TGTTACCATAAAAGGAAGCTGGG - Intronic
1071292603 10:84198258-84198280 TGACAACTTCAGAGGCAGTTGGG - Intronic
1071537778 10:86450100-86450122 TGTCACCATTTGAGGAAGTTAGG + Intronic
1071962272 10:90818572-90818594 TGAGAACATGAGAGGAAGCAGGG - Intronic
1072313172 10:94176838-94176860 TGGCACCAACAGAGAAGGCTGGG + Intronic
1073674914 10:105635004-105635026 TGAAACCATTAGGGGAAACTAGG + Intergenic
1073768973 10:106714474-106714496 TGTTAACATTAGAGGAAGCTGGG + Intronic
1073971894 10:109053138-109053160 TGACACAATAAGAGGAAGGTTGG - Intergenic
1074123376 10:110509651-110509673 TGGAACCATCAGTGGAACCTAGG + Intronic
1076057356 10:127386599-127386621 TGATCCCATCAGGGGAAGATGGG - Intronic
1077328563 11:1974076-1974098 TGACTCCATCAGAGGAGGTCCGG + Intronic
1078286882 11:9965666-9965688 TGTCACCATAGGGGGAAGCTGGG - Intronic
1080459360 11:32439515-32439537 TGAAATGATCAGAAGAAGCTGGG - Intergenic
1081002221 11:37689064-37689086 TGAAGCCTTCAGAGGAAGCATGG + Intergenic
1083093179 11:60221409-60221431 TGAGACCATCAGTGCAGGCTGGG - Intronic
1084276496 11:68053995-68054017 TTCCACCAGAAGAGGAAGCTTGG - Exonic
1084742033 11:71146265-71146287 TGAATCCACCAGAGCAAGCTGGG - Intronic
1084934509 11:72579664-72579686 TGACCCCAAGAGAGGAAGCAGGG + Intronic
1085025505 11:73234186-73234208 TGACACCATCAATGGCACCTGGG + Exonic
1085737687 11:79053655-79053677 TCCCACCATCAGAGGAAGCCAGG + Intronic
1088622134 11:111696361-111696383 TGTTAACATTAGAGGAAGCTGGG + Intronic
1089535695 11:119159736-119159758 GGACACCGTCACAGGATGCTTGG + Intronic
1091880591 12:3974230-3974252 AGAGCCCAGCAGAGGAAGCTGGG + Intergenic
1096856118 12:54484751-54484773 TGCCACAATCACAGGAAGATGGG - Intergenic
1097857674 12:64482983-64483005 TGCCACCATTGGGGGAAGCTGGG + Intronic
1098784988 12:74742001-74742023 TGACAGCATCTGAAGCAGCTGGG - Intergenic
1102482631 12:113234201-113234223 TGTCACCATCTGTGGAAACTAGG + Intronic
1102691971 12:114768442-114768464 TGACATCATCAGACCAATCTGGG - Intergenic
1104394281 12:128418622-128418644 TGGTACCACCAGCGGAAGCTGGG - Intronic
1104521809 12:129482523-129482545 TGACACCATATTAGGAAGGTGGG + Intronic
1104828836 12:131734092-131734114 TGACACCTGCAGCGGAGGCTGGG + Intronic
1105009172 12:132744062-132744084 TGACACCATCCGGGGAAGGAGGG - Intronic
1106675683 13:31955706-31955728 GGACAACATCAGATGAACCTGGG - Intergenic
1106914704 13:34500019-34500041 TGAGACCTTCAGAGGAATCTGGG + Intergenic
1110022537 13:70492950-70492972 TGAGTCAATCAGAGGAAGCAAGG - Intergenic
1110391280 13:74977513-74977535 TGTCACCATTGGAGGAAGCTGGG + Intergenic
1111900692 13:94196123-94196145 TGTCATTATCAGAGGAAGCCGGG + Intronic
1113122516 13:106939484-106939506 AGAGACCATCAGAGGAAGTCAGG + Intergenic
1113352587 13:109543999-109544021 GGAACACATCAGAGGAAGCTGGG - Intergenic
1114905356 14:27120269-27120291 TGACACCATCAGTGCAGGCTGGG + Intergenic
1115630539 14:35240472-35240494 TGACACCAGCAAAAGAAGGTGGG - Intronic
1116965287 14:51008321-51008343 TGTAACCATCAAAGCAAGCTGGG + Intronic
1117741063 14:58819864-58819886 TTTCATCATCAGAGGAGGCTGGG + Intergenic
1118040321 14:61909391-61909413 TGGCACCTTCAGAGGGAGCATGG - Intergenic
1118604570 14:67493336-67493358 TGACATCATCAAAGGAGGCAAGG - Intronic
1119968621 14:78944540-78944562 GGACACCATCATAGGAATCAGGG - Intronic
1121268652 14:92622682-92622704 TGACATCATCAAAGGAGGCAAGG + Intronic
1121269430 14:92628055-92628077 TGACATCATCAAAGGAGGCGAGG + Intronic
1121614763 14:95306054-95306076 TGAAGCCATCAGAGGAAGGCAGG + Intronic
1121790757 14:96697904-96697926 TCACACCACCAGAGGAAGCGGGG - Intergenic
1125375724 15:39026743-39026765 ATAAACCATCAGAAGAAGCTAGG - Intergenic
1126701303 15:51370272-51370294 TGATCCCATCAGAGGATGCTGGG - Intronic
1126888488 15:53178294-53178316 TGTTAACATTAGAGGAAGCTGGG - Intergenic
1127730275 15:61794883-61794905 TGCTAACATTAGAGGAAGCTGGG - Intergenic
1128998311 15:72313024-72313046 TGACAGTATCAGAGGAAGCCAGG + Intronic
1129801034 15:78414522-78414544 TGTGACCATTGGAGGAAGCTGGG - Intergenic
1130119466 15:81035016-81035038 TGTCACCATTAGGGGAAGCTAGG - Intronic
1131544617 15:93305611-93305633 TGAGACCAGCTGATGAAGCTGGG + Intergenic
1131898035 15:97054933-97054955 TGTTACCATCAGAGAAAACTGGG - Intergenic
1133388612 16:5390856-5390878 TGTCACCATAAGGGAAAGCTAGG + Intergenic
1134829607 16:17312532-17312554 TGTCACCATTGGGGGAAGCTGGG - Intronic
1135160146 16:20087092-20087114 TGTCACCATCAGAGCATGCCTGG + Intergenic
1139335168 16:66226395-66226417 TGACATCAGCAGAGGCGGCTGGG - Intergenic
1140492340 16:75348342-75348364 TGTCAGCATTAGAAGAAGCTGGG + Intronic
1140492896 16:75354881-75354903 TGTTAACATCAGAGAAAGCTGGG + Intronic
1141646742 16:85371613-85371635 TGCCAGCAGCAGAGGCAGCTGGG - Intergenic
1142529447 17:569377-569399 TGTCAACATCAGGGGAAGTTGGG + Intronic
1142957571 17:3531946-3531968 GGACGCCATCAGAGGACACTGGG - Intronic
1144991953 17:19238885-19238907 TTACATAATGAGAGGAAGCTTGG - Intronic
1145980994 17:29011480-29011502 AGACACCATGGGAGGATGCTGGG + Intronic
1149002040 17:51767432-51767454 TGTCAACATTAGGGGAAGCTGGG - Intronic
1149764419 17:59263120-59263142 TGTCACCTTTTGAGGAAGCTGGG + Intronic
1151533760 17:74725401-74725423 TGCCACCATAAGAGCAACCTTGG + Intronic
1153084674 18:1271026-1271048 TGACAGCATCAGAGGAGGATAGG + Intergenic
1155600312 18:27538466-27538488 TGTTACCATCAGGGGAAGCTGGG + Intergenic
1156095899 18:33531289-33531311 TGTCACCATCAGAGGAATGGAGG + Intergenic
1156206340 18:34889982-34890004 TGACAGCATTATAGGTAGCTGGG - Intronic
1156300468 18:35832120-35832142 TGACATCATCAAAGGAGGCAAGG - Intergenic
1157137730 18:45073432-45073454 TGTTAACATCAGAGGAAGCTGGG - Intergenic
1157647893 18:49295869-49295891 TACTACCATTAGAGGAAGCTGGG - Intronic
1159866416 18:73711496-73711518 TGACAGCCTCAGAAAAAGCTGGG + Intergenic
1160623106 18:80184546-80184568 TGAAACCCTCAGAGGGAGCAAGG + Intronic
1161191359 19:2958728-2958750 TGTCACCATTGGAGGAATCTAGG - Intergenic
1162237291 19:9319369-9319391 TGTTACCATCCGAGGAATCTTGG - Intergenic
1166014587 19:39970681-39970703 TGTCACCTTCAGGGGCAGCTCGG + Intergenic
1166103276 19:40583729-40583751 TGACAGCAGCAGGGGAAGCCGGG - Intronic
1166531721 19:43546878-43546900 TCAGACCTTCTGAGGAAGCTTGG + Exonic
1166645994 19:44532199-44532221 TGAGACCATCAGACGAGGCCAGG + Intergenic
1168150819 19:54447557-54447579 TGACAGCATCAGAAGAAAGTGGG + Intergenic
925273566 2:2632980-2633002 TGACATCCTCAAAGGAAGCCGGG + Intergenic
926290173 2:11522704-11522726 TGACACAAGCAGAGGGACCTGGG + Intergenic
927008752 2:18880004-18880026 TGAGACCATCAGTGCAGGCTAGG - Intergenic
928739406 2:34332278-34332300 TGAGAACATCATATGAAGCTGGG + Intergenic
929028731 2:37630418-37630440 TGAGAGCATCAGTGGAAGCCAGG + Intergenic
929503815 2:42512649-42512671 TGGCATCATCAAAGGAAACTTGG - Intronic
930067168 2:47336499-47336521 TGTCACCATCAGGGAGAGCTGGG - Intergenic
930155369 2:48101943-48101965 TGTTACCATCAGAGTAAACTGGG + Intergenic
931679869 2:64737085-64737107 TGGCAGCATCAGTGGAAGATAGG + Intronic
932962963 2:76436918-76436940 TGACACCACCATAGAAAGATGGG - Intergenic
935699449 2:105798840-105798862 TGTTAACATCTGAGGAAGCTCGG - Intronic
936831486 2:116653442-116653464 AGACACCAACTGGGGAAGCTAGG + Intergenic
937528449 2:122799658-122799680 GGAAACCACCAGAAGAAGCTAGG - Intergenic
940237518 2:151527058-151527080 TGACAGCACAGGAGGAAGCTGGG + Intronic
941019353 2:160391358-160391380 TGGCACCTTCAGAGGGAGCATGG + Intronic
943847775 2:192673880-192673902 TGCCTCCATCAGAGCAAGTTAGG - Intergenic
944366019 2:198920406-198920428 TGATACCATCAGTGGGGGCTTGG - Intergenic
945660982 2:212684943-212684965 TGAAACCATCAGAAGAAGAATGG - Intergenic
945717803 2:213380388-213380410 TGATGCCATCAGTGCAAGCTGGG + Intronic
947905292 2:233757028-233757050 TGAGAACATCAAAGGAAGTTTGG + Intronic
948932968 2:241143976-241143998 TGTCACCATGAGAGGGAACTCGG - Intronic
1173174030 20:40750844-40750866 TGACCCCAAGAGAGGAAGCCTGG + Intergenic
1173549964 20:43925910-43925932 TGACAGCTGCAGAGCAAGCTCGG - Intronic
1173756766 20:45523306-45523328 AGACACAACCAGAGGAAGATGGG - Intergenic
1173766450 20:45614619-45614641 AGACACCTTCAGAGGTAGGTGGG - Exonic
1174255482 20:49251489-49251511 TGACACCATCCAAGAAAGATCGG + Intronic
1174332648 20:49832155-49832177 TGTCTCCATGAGAGGAAGGTGGG - Intronic
1174371314 20:50090050-50090072 GGAGGCCAGCAGAGGAAGCTTGG - Intronic
1175208712 20:57332689-57332711 TGCCACCTTTAGGGGAAGCTTGG + Intronic
1175755085 20:61524411-61524433 TGTCGTCAGCAGAGGAAGCTGGG + Intronic
1177279207 21:18957569-18957591 TGTGTCCATCAGAGGATGCTTGG - Intergenic
1178346224 21:31830649-31830671 TCTCACCATCAGAGCAAGCAAGG + Intergenic
1178389331 21:32185454-32185476 TGACAGCATCACAGGTAGCCTGG - Intergenic
1178912938 21:36690833-36690855 TGGCACCGTGAGAGGAAGGTTGG + Intergenic
1178949780 21:36976654-36976676 TGTTAGCATTAGAGGAAGCTGGG + Intronic
1181494940 22:23282463-23282485 TGTCACCATCATAAGCAGCTTGG - Intronic
1185101284 22:48842217-48842239 AGGCACCATTAGCGGAAGCTTGG - Intronic
950371995 3:12538819-12538841 TGACACCTTCACAGGAGGCTGGG - Intronic
952171631 3:30813507-30813529 TGACAGCATCACAATAAGCTGGG - Intronic
953331955 3:42061180-42061202 TGTTAACATTAGAGGAAGCTGGG - Intronic
953920196 3:46946546-46946568 TGACAGCATCAGGTGAGGCTGGG - Intronic
953978322 3:47399398-47399420 AGACAGCATAAGAAGAAGCTTGG - Intronic
954906835 3:54070343-54070365 TGACATCATCAAAGGAGGCGAGG - Intergenic
955199663 3:56839513-56839535 TGTTAACATCAGGGGAAGCTGGG + Intronic
961200795 3:125043765-125043787 TCACACCCAGAGAGGAAGCTGGG + Intronic
963630341 3:147723488-147723510 TGAAACCATCAGTGCAGGCTGGG - Intergenic
964221774 3:154354852-154354874 TGACAGCATGGAAGGAAGCTGGG + Intronic
964629743 3:158797728-158797750 TGAAACCATCAGACACAGCTGGG + Intronic
965280843 3:166750601-166750623 TGAAAGTATCAGAGGAAACTTGG - Intergenic
969349154 4:6588223-6588245 TCACACCTTCAGAGGGAGCGTGG - Intronic
969386699 4:6855028-6855050 GGTCACCATCACAGCAAGCTGGG - Intronic
970071276 4:12162445-12162467 TGACACCAGCTGAGGCAGCCAGG - Intergenic
972769736 4:42186093-42186115 TGGCACCTTCAGAGGGAACTTGG + Intergenic
973563674 4:52162520-52162542 TGACACCCTCAGAGTGGGCTGGG + Intergenic
974624273 4:64401314-64401336 TTACACCAACCCAGGAAGCTTGG + Intronic
976932422 4:90584425-90584447 TGACAGCAACAGAAAAAGCTTGG + Intronic
978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG + Intergenic
978984393 4:114992369-114992391 TGTCAACAACAGAGGAATCTGGG - Intronic
980450744 4:132967770-132967792 TAACACCTTCGGAGGAAGCAAGG - Intergenic
981114473 4:140973940-140973962 TGACACCATCAGAGGAAGCTGGG - Intronic
981241643 4:142483626-142483648 TGATATGATTAGAGGAAGCTGGG + Intronic
984576207 4:181451412-181451434 AGAAACCATTAGAGGAATCTAGG + Intergenic
985887465 5:2690760-2690782 GGAGACCATCAGCAGAAGCTAGG + Intergenic
985931706 5:3063474-3063496 TGTTCGCATCAGAGGAAGCTTGG + Intergenic
986292235 5:6409546-6409568 TGGGAGCATGAGAGGAAGCTAGG + Intergenic
988611424 5:32729845-32729867 TGGTAACATTAGAGGAAGCTTGG - Intronic
988662590 5:33288809-33288831 TGTCAACATTAGAGGAGGCTGGG - Intergenic
988720761 5:33876837-33876859 TGTTGCCATCAGAGGAAACTGGG + Intronic
989304105 5:39931736-39931758 TGACACAGTCAAAGGAAGCGGGG + Intergenic
989462759 5:41719805-41719827 TGATCCCATCAGAGGAAAATAGG - Intergenic
990338110 5:54794789-54794811 TGTTAACATCAAAGGAAGCTGGG + Intergenic
990604446 5:57394920-57394942 TGTTACCATTAGAGGAAACTGGG - Intergenic
991215369 5:64153527-64153549 TGACATCATCAAAGGAGGCAAGG - Intergenic
991511669 5:67384471-67384493 AGACACCATCAAAGGAGACTGGG - Intergenic
991527119 5:67572510-67572532 TGACAGCATGAGAGGAAGAGAGG - Intergenic
992962580 5:81971299-81971321 TGTCACCATTGGAGGAAACTAGG - Intergenic
995238837 5:109862247-109862269 TGAAGCCATCAGATAAAGCTGGG - Intronic
996456503 5:123689793-123689815 TGTTACCATTAGAGGAAACTGGG + Intergenic
996748767 5:126868527-126868549 TGACATCATCAAAGGCAGCCAGG - Exonic
997690092 5:135822464-135822486 TTGCATCATCACAGGAAGCTAGG - Intergenic
1001691833 5:173639041-173639063 AGACCCCAGCAGAGGAAGCCTGG - Intergenic
1001879446 5:175230730-175230752 TGAAACCATCAAAGGAAGAAGGG + Intergenic
1002641810 5:180634004-180634026 GGGAGCCATCAGAGGAAGCTGGG - Intronic
1003261122 6:4517149-4517171 TGATACCATGCAAGGAAGCTGGG - Intergenic
1007988491 6:46231304-46231326 TGACACCTTCAGAGACAGCATGG + Intronic
1008555209 6:52666857-52666879 TAACACCATCAGTGGAAGCAAGG + Intergenic
1010493055 6:76496850-76496872 TGCCACCAGCAGTGGAACCTAGG - Intergenic
1013686974 6:112596340-112596362 TGAGATCATCAGAGAGAGCTTGG - Intergenic
1016336137 6:143007141-143007163 AGACACCATTAGTTGAAGCTGGG + Intergenic
1016432508 6:144002113-144002135 TGTTAACATGAGAGGAAGCTGGG + Intronic
1017024900 6:150173101-150173123 TGTCAACATTGGAGGAAGCTGGG - Intronic
1017267912 6:152472528-152472550 TGCCACATTCAGAGGCAGCTTGG + Intronic
1017898557 6:158701817-158701839 TAGCACCAGCAGAGGAAGCATGG - Intronic
1022265644 7:28751673-28751695 TGTTAACATTAGAGGAAGCTTGG - Intronic
1022807313 7:33835499-33835521 TGACACCATCAGGGTCAGCGGGG - Intergenic
1024433520 7:49320361-49320383 TATCACCATTGGAGGAAGCTGGG + Intergenic
1026954160 7:74366264-74366286 AGACGCCAGCAGAGGAGGCTGGG - Intronic
1029139694 7:98401077-98401099 GGACGCCGCCAGAGGAAGCTGGG + Intergenic
1029966102 7:104742597-104742619 TGACACCAGCTGAGGAGCCTTGG + Intronic
1030230901 7:107207415-107207437 CTACACCATCAGAGAATGCTTGG - Intronic
1033493501 7:141869275-141869297 TAAAAATATCAGAGGAAGCTGGG + Intergenic
1037554237 8:20006676-20006698 TGTTACCATCAGGGGAAACTGGG + Intergenic
1037572367 8:20169369-20169391 TGACACAATCAGAGTAGGCACGG + Intronic
1038812345 8:30861633-30861655 TGTTAACATCAGAAGAAGCTGGG + Intronic
1038953151 8:32438043-32438065 TGTCACCATTGGAGGAAACTGGG - Intronic
1041527387 8:58822599-58822621 TGAGACCTTCAGAGGAATCTGGG - Intronic
1041956777 8:63565154-63565176 TTGCATGATCAGAGGAAGCTGGG + Intergenic
1043856239 8:85268654-85268676 TGATTCCCTCAGAGGAAACTGGG + Intronic
1047152699 8:122282682-122282704 TGTTAACATTAGAGGAAGCTAGG + Intergenic
1047843556 8:128780888-128780910 TGACTGCCTCAGAGGAAGCTAGG + Intergenic
1048772239 8:137907316-137907338 TAGCACCTTCAGAGGAAGCCTGG - Intergenic
1049451974 8:142666833-142666855 AGAAGCCATCAGAGGAAGCCAGG + Intronic
1057088137 9:92229707-92229729 TGTCACCATTAGGGGAAACTGGG - Intronic
1057807748 9:98232701-98232723 TGTCACCATCAGGGGAAGCTTGG - Intronic
1058544134 9:106042474-106042496 TGAGACCATCAGTGCAGGCTGGG + Intergenic
1059465051 9:114463613-114463635 TGTCAACACTAGAGGAAGCTGGG + Intronic
1060203751 9:121669306-121669328 TGCAACCATCAGAGAAAACTGGG - Intronic
1060825552 9:126685691-126685713 TGGCACCCTCAGAGGAGGGTAGG + Intronic
1061041779 9:128144851-128144873 TGGCACCATCAGAGGTGGCTGGG - Intergenic
1061990458 9:134156006-134156028 TGACACCTTCCGAGGGCGCTGGG + Intronic
1186441443 X:9590268-9590290 TGTCAACATAAGTGGAAGCTGGG + Intronic
1187264238 X:17716830-17716852 TGCTTCCATCAGAGGAAGCAAGG + Intronic
1187703694 X:21988816-21988838 TGTCAGCATCCCAGGAAGCTGGG + Intronic
1188328659 X:28840221-28840243 TGCCACTATCAGAGGAAGATGGG - Intronic
1189116720 X:38350527-38350549 TGACATAATCAGCAGAAGCTGGG + Intronic
1189660698 X:43295021-43295043 TGAAACCATTAGATGAAGTTTGG + Intergenic
1189836822 X:45032214-45032236 TGCAACCAACAGAGGCAGCTAGG - Intronic
1189976893 X:46470204-46470226 TGTCACCATTAGTGGAAACTGGG - Intronic
1190103028 X:47537312-47537334 TGTCACCATTGGAGGAAACTGGG + Intergenic
1191133999 X:57044208-57044230 TGAGACCATCAGTGCAGGCTGGG + Intergenic
1191739430 X:64421132-64421154 TGTCACCATCAGGGGAAACATGG + Intergenic
1192544244 X:71999701-71999723 TGTCAACATAAGGGGAAGCTGGG + Intergenic
1193149727 X:78112618-78112640 TGAAACCATCAAAGGAAATTTGG - Intronic
1193667779 X:84344320-84344342 TCACACCAGGAGAGGAAGCTGGG - Exonic
1195366150 X:104127572-104127594 TGCCACCGTTAGAGGAAGCGTGG + Intronic
1195782318 X:108479586-108479608 TGACACCATCATTGCATGCTGGG + Intronic
1197239979 X:124113763-124113785 TGACACCATCAAAGGAACAAAGG - Intronic
1197309557 X:124887709-124887731 TTACACTATCAGAGGAAGTGTGG - Intronic
1197937527 X:131754568-131754590 TGAGACCATTAGACGAAACTCGG - Intergenic