ID: 981121858

View in Genome Browser
Species Human (GRCh38)
Location 4:141060574-141060596
Sequence CCTTTGTTTACATTTTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981121858 Original CRISPR CCTTTGTTTACATTTTACCC TGG (reversed) Intronic
902892602 1:19455182-19455204 CCTTTGTTTCCCCTTAACCCAGG - Intronic
908297209 1:62724656-62724678 CATGTGTTTTCATTTTGCCCTGG - Intergenic
909334313 1:74453559-74453581 TCTTTGTTTATATTTTTCCCAGG - Intronic
910220901 1:84888847-84888869 CCTGTGTCTACATTGTTCCCTGG - Intronic
911348371 1:96722493-96722515 CCTTTGTTTTCATTTGAGTCTGG + Intronic
913511099 1:119563287-119563309 CCTCAGTTGCCATTTTACCCTGG - Intergenic
914417941 1:147501890-147501912 CCTTTCTTTATAAATTACCCAGG - Intergenic
917543450 1:175937586-175937608 CATTTGTTTACATTTTCTCTAGG + Intergenic
918326459 1:183415973-183415995 ACTTTGTTCACATTCTGCCCTGG + Intronic
920354403 1:205359930-205359952 TCTTTGTTTGCATTTTAACCTGG - Intergenic
921784540 1:219213886-219213908 CTTTTGTTTGCATATTACACTGG + Intergenic
922782283 1:228262848-228262870 CCTTTCTTTATTTTTTACCCTGG + Intronic
1063645937 10:7883804-7883826 CCTTTCTTTATAAATTACCCAGG - Intronic
1064093817 10:12407799-12407821 AATTTGTTTTCATTTTTCCCAGG - Intronic
1064815690 10:19259370-19259392 CCTTTCTTTATAAATTACCCAGG - Intronic
1066805959 10:39253758-39253780 CCTCTGTCTACTTTTTATCCAGG + Intergenic
1068017069 10:51530646-51530668 CCTTTGTTGATATTTTGCCTGGG + Intronic
1068581072 10:58740501-58740523 CTTTTGTTTCCATATTTCCCTGG + Intronic
1071419245 10:85473795-85473817 CCTTTGTTTAAATTCTACAGTGG + Intergenic
1072992101 10:100206368-100206390 CTATTGTTAACATTTTACCTGGG - Intronic
1073854824 10:107662172-107662194 CCTTTCTCTACATTAAACCCGGG - Intergenic
1075353525 10:121747841-121747863 CCTTTGTTTGTCATTTACCCTGG - Intronic
1075873970 10:125791159-125791181 CCTTTGCCTACTTTTAACCCAGG - Intronic
1076455545 10:130591296-130591318 TCTTTCTTTACAAATTACCCAGG - Intergenic
1076559779 10:131354182-131354204 TCTGTGGTTACAGTTTACCCTGG + Intergenic
1077440467 11:2566469-2566491 CCTCTGTTCACATTTTACAGAGG - Intronic
1078181750 11:9017511-9017533 CTTTTATTTACATGTTTCCCAGG + Intergenic
1079539346 11:21553005-21553027 CCTTTGTTTACATTAAAACCTGG + Intronic
1079614559 11:22475470-22475492 CCTTTGTTGCCATTTAACACTGG - Intergenic
1079715499 11:23738505-23738527 TATTTGTTTTCAATTTACCCTGG + Intergenic
1079784554 11:24655149-24655171 TCTTTGTTTCTATTTTACACTGG + Intronic
1079923680 11:26464995-26465017 CCTTTGTGTACATTTGTCACAGG + Intronic
1082049632 11:47760303-47760325 CATGTGATTACATTTCACCCTGG - Intronic
1083702273 11:64487300-64487322 CCTGTGTTTTCATTTTGCACCGG + Intergenic
1084995210 11:72970449-72970471 CATGTGTTCACATTTTAACCTGG + Intronic
1085242214 11:75067214-75067236 CACTTGCTTACATTTTACTCAGG - Intergenic
1090109523 11:123890577-123890599 CATTTGTTTTCATTTTACCTGGG + Intergenic
1092503358 12:9069574-9069596 CCTTTATTTATATTTCACCAGGG - Intronic
1093791358 12:23254142-23254164 CCCTTTTTTATATTTTAACCAGG - Intergenic
1094774300 12:33705700-33705722 CAATTGTTTAGAATTTACCCTGG + Intergenic
1094788082 12:33874535-33874557 GCTTTATTTACATTTTACAGTGG + Intergenic
1095339443 12:41071637-41071659 CATTAGTTTACATTTAACTCTGG + Exonic
1096264616 12:50113000-50113022 CCTTTTTTTAAAAATTACCCGGG - Intronic
1096545008 12:52332178-52332200 CCTTTGTATGCATTATCCCCTGG + Intergenic
1097691802 12:62740740-62740762 CCTGTGTTTTCATTTTGCGCTGG - Intronic
1097887111 12:64740020-64740042 CATTCATTTACATGTTACCCAGG + Intronic
1098072750 12:66693629-66693651 AATTTGTGTACATTTTACCGGGG - Intronic
1102858243 12:116313525-116313547 CTTTTGTTTTCATTTTGCTCTGG + Intergenic
1103925104 12:124419334-124419356 TGTTTGTTTACATATTACCATGG - Intronic
1104392091 12:128399909-128399931 CATTTGTTTACATTTGTCTCTGG + Intronic
1104835886 12:131790117-131790139 CCTTTGTTTAAATCTCACCGTGG + Intronic
1106431818 13:29688008-29688030 CCTTCGTTTTCATTTTGCACTGG - Intergenic
1106635908 13:31528325-31528347 CCAGTGTTTACATTTTGCGCTGG + Intergenic
1106797485 13:33221659-33221681 CCTGTGTTTTCATTTTGCACTGG - Intronic
1108171739 13:47748956-47748978 CCTTTGTGTTCATTCTCCCCGGG + Intergenic
1109727324 13:66359735-66359757 CCTTTGTTTCCATTTAATTCAGG - Intronic
1109770475 13:66964601-66964623 TTTTTTTTTACATTTTGCCCAGG - Intronic
1109924170 13:69112615-69112637 CATTTGTTTTCATTTTACTGAGG + Intergenic
1110047293 13:70846139-70846161 CCTTTGATAACTTTTTAACCGGG + Intergenic
1111203947 13:84978781-84978803 GCGTTGTTCACATTTTACCAGGG - Intergenic
1111596398 13:90417368-90417390 CATTTCTTTACATTTTATCTAGG - Intergenic
1111640416 13:90962672-90962694 CATTTGTTTTCATTTCAGCCTGG - Intergenic
1111717144 13:91893808-91893830 CCATTGTTTACATTTTAGCTAGG + Intronic
1111906788 13:94264675-94264697 CCTCTTTTTAAATTTTACCATGG - Intronic
1112535621 13:100252232-100252254 CTTTTGTTTTCTTTTTACCTTGG + Intronic
1112792383 13:103016979-103017001 CCTTTGTTTCTATTTAACCCAGG - Intergenic
1114227770 14:20754462-20754484 CCAGTGTTAACATTTTACCTGGG - Intergenic
1115526282 14:34283735-34283757 CCTGTGTTTTCATTTTGCCCTGG - Intronic
1116135073 14:40912735-40912757 CATATGTTTAGATTTTATCCAGG + Intergenic
1116641185 14:47465498-47465520 CCTTTGCTTACATTTTAATGGGG - Intronic
1117699632 14:58399968-58399990 GCTTTTATTACCTTTTACCCAGG + Intronic
1118031127 14:61819033-61819055 CCTATGTTTTCATTTCACCATGG + Intergenic
1118954184 14:70464820-70464842 CCTTTGTGCACCTTTTATCCTGG + Intergenic
1120740124 14:88099298-88099320 CCTTTGTTTACATTTCTCTTTGG - Intergenic
1123503294 15:20911963-20911985 CCTCTGTCTACAATTTTCCCTGG + Intergenic
1123560542 15:21485628-21485650 CCTCTGTCTACAATTTTCCCTGG + Intergenic
1123596780 15:21922924-21922946 CCTCTGTCTACAATTTTCCCTGG + Intergenic
1123980977 15:25602466-25602488 CCTTTGTTCATTTTTTAACCAGG + Intergenic
1125184773 15:36917680-36917702 CCTTAGGTGACATTTTACCCAGG - Intronic
1126333282 15:47557287-47557309 TCTATGTTTTCATTTTAACCAGG - Intronic
1128383362 15:67129676-67129698 CCTCTCTTTACATTTTAACATGG - Intronic
1128521163 15:68375720-68375742 CCTTTGTGTGCATTTTAAACAGG + Intronic
1129163546 15:73761691-73761713 CTTTTGTTTATAAATTACCCAGG + Intergenic
1129576207 15:76748667-76748689 CCTTTGCTCACATTTTACCTGGG - Intronic
1130832292 15:87613712-87613734 CCTTGGTTTATATTTTTCCGTGG - Intergenic
1131776938 15:95812903-95812925 CCTCTGATATCATTTTACCCAGG + Intergenic
1202968889 15_KI270727v1_random:212792-212814 CCTCTGTCTACAATTTTCCCTGG + Intergenic
1133366673 16:5215777-5215799 CCTTTGTATATATTTTTCCCTGG - Intergenic
1136357494 16:29755011-29755033 CAATTGTTTACATTTTAGCCAGG + Intergenic
1138358351 16:56404435-56404457 TCATTGTTTACATTTTACTTTGG - Intronic
1138416870 16:56876634-56876656 CCTCTGTTCCCATTTTCCCCAGG + Intronic
1143249545 17:5512740-5512762 CCTGTGTTTCCATTTTGCACTGG + Intronic
1145710283 17:26965048-26965070 CCTTTTTTTAAATTTTAAACAGG - Intergenic
1152819856 17:82432025-82432047 CTTATTTTTACATTTTAGCCTGG + Intronic
1154361272 18:13663580-13663602 CCTTTTTGTGCATTTTACACAGG + Exonic
1154971395 18:21413243-21413265 ACTTTGTTTCCATTTCCCCCAGG + Intronic
1155176195 18:23303366-23303388 CCTTTCTTTCCATTTTTCTCAGG + Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156904587 18:42337887-42337909 CTTTTGTTTATAAATTACCCAGG - Intergenic
1158066563 18:53417251-53417273 CCTGTGTTTACATTCTTCTCTGG + Intronic
1160126816 18:76182541-76182563 TCTAAGTTTACATTTTAGCCAGG + Intergenic
1161222981 19:3126555-3126577 CCTGTGTTTTCATTTTGCTCCGG - Intergenic
1162891466 19:13736174-13736196 TCTTTGTATACATATTAGCCAGG - Intronic
1165822204 19:38683755-38683777 CCTTGGATTACTTTTTACCTTGG + Intronic
1166610102 19:44184029-44184051 CCAGTTTTTACATATTACCCAGG + Intergenic
1168037240 19:53729772-53729794 CTTTTGTGTCCATTTTAACCCGG + Intergenic
925232926 2:2252045-2252067 TTTTAGTTTACATTTTCCCCTGG - Intronic
925312543 2:2896079-2896101 CCTTTCTTTATAAATTACCCAGG - Intergenic
925457871 2:4032239-4032261 CCTTTGTCTACATTTTAATGGGG + Intergenic
925657650 2:6166528-6166550 CCCTTGTTTCCATTTTATACAGG - Intergenic
926629962 2:15127151-15127173 CCGTTGTTTTCATTTTGCACTGG + Intergenic
927242269 2:20929488-20929510 CTTTTCTTTACAAATTACCCAGG - Intergenic
928070043 2:28205952-28205974 CATTTGTTTAAATTTTTCCGTGG + Intronic
928784509 2:34866408-34866430 CCTTGATTTTCATTTTACCAGGG - Intergenic
929457414 2:42075676-42075698 CCTGTATTTTCATTTTACACTGG - Intergenic
929653543 2:43706497-43706519 CCATTCTTAACATTTTACACAGG + Intronic
931833045 2:66072312-66072334 CATTTGGTCACATTTTAGCCTGG + Intergenic
933396195 2:81734312-81734334 CTTTTGTTTACATATTATCTAGG - Intergenic
935779422 2:106498485-106498507 CTTTGGTTTGCATTTTGCCCTGG - Intergenic
937038115 2:118799164-118799186 CTTTTGTGTATATTTTATCCTGG + Intergenic
937556322 2:123162197-123162219 CATTTATTTACATTTAACCCAGG + Intergenic
937683131 2:124666069-124666091 CTTTGGGTTATATTTTACCCAGG - Intronic
939104128 2:137929372-137929394 CCTGTGTCTAGATTTCACCCTGG + Intergenic
940141234 2:150493293-150493315 CCTTTGTTCACAGGTTACTCAGG - Intronic
940466628 2:154037781-154037803 CCTAAGATTACATTTTACCAAGG + Intronic
940887216 2:159000353-159000375 CCTTTCTTCCCATTTTACTCAGG - Intronic
942468600 2:176235202-176235224 CCTGTGTTTTCATTTTGCACGGG - Intergenic
942808388 2:179963873-179963895 ACACTGTTTACATTTTACACTGG - Intronic
943380040 2:187133317-187133339 CCTTTGTTTAAAATTTACAATGG - Intergenic
944830586 2:203530399-203530421 GCTTTGTTTTGATTTCACCCAGG + Intronic
944899649 2:204201157-204201179 CCTTTGTTCCCATTTTACAGTGG + Intergenic
946731420 2:222713173-222713195 CCTGTGTTTCCATTGCACCCTGG + Intergenic
946927269 2:224638178-224638200 ACTTTCTTCACAATTTACCCAGG + Intergenic
947053200 2:226070519-226070541 CATTTGTTTAAATTTTACATAGG - Intergenic
947309398 2:228783958-228783980 CCTTTGTGTACATTTTTCACTGG + Intergenic
948245719 2:236483702-236483724 GAATAGTTTACATTTTACCCTGG - Intronic
1173531876 20:43776009-43776031 CCTGTGTTCACCTGTTACCCAGG + Intergenic
1175515415 20:59566985-59567007 CATTTGTTTACATATTATCTGGG + Intergenic
1177766697 21:25466477-25466499 CTTTTGTTTTATTTTTACCCAGG - Intergenic
1177842369 21:26248899-26248921 CCTGTGTTTTCATTTTGCACTGG + Intergenic
1178061014 21:28853215-28853237 CCTTTCTTTACATTAAACCAAGG + Intergenic
1178252242 21:31014900-31014922 TTTTTGTTTACATTTTACTTAGG + Intergenic
1178836716 21:36104769-36104791 CCCTTGATTACATTTCCCCCAGG + Intergenic
1182063515 22:27414802-27414824 CCTTGGTCTCCATTTTAACCTGG + Intergenic
953649557 3:44789102-44789124 TCTTTGTTTTCAGTTTATCCTGG + Intronic
955240493 3:57173864-57173886 CCCCTGTTTACATTTTAGCAGGG + Intergenic
955884700 3:63585299-63585321 CCTTGGTTTTCATTTCATCCTGG - Intronic
956904428 3:73750958-73750980 CATTTGTTTCCATATTACCATGG - Intergenic
957121624 3:76101806-76101828 CCTGTGTTCCCATTATACCCCGG + Intronic
957429789 3:80088360-80088382 CCTTTCTTTTCTTTTTACGCTGG + Intergenic
957634177 3:82760067-82760089 CCTTCCTTTACATTAAACCCAGG - Intergenic
957792109 3:84954652-84954674 CCTTTCTCTACATTTTCCTCAGG - Intergenic
958582334 3:96043429-96043451 CATTTGTTTTCATTTTTCTCAGG + Intergenic
959544826 3:107582514-107582536 CCTTTGTTGAAATTTGTCCCTGG - Intronic
960550677 3:118972927-118972949 TCTTTGTCTAGAATTTACCCAGG - Intronic
961925179 3:130471965-130471987 CCTTTGTTTGGATTTTCCCCTGG + Intronic
961950129 3:130740872-130740894 CTATTGTTAACATTTTGCCCTGG - Intronic
962487676 3:135860865-135860887 CCTTTGTTTACATCTTTCCCTGG + Intergenic
962525272 3:136232594-136232616 TCTTTGTTTATATTCTCCCCTGG + Intergenic
964746978 3:160021747-160021769 CCTTTGTTTTCATTTAAGACAGG - Intronic
965254644 3:166389964-166389986 TCTTTGCTTACATTTTACATCGG - Intergenic
966203555 3:177382547-177382569 CTCTTATTTAAATTTTACCCAGG + Intergenic
967109503 3:186281250-186281272 CCTCTGTTTCCTTTTTACCATGG + Intronic
967301899 3:188022397-188022419 TTTATGTTTACATTTTACCCTGG - Intergenic
967973614 3:195017615-195017637 AATTTTTTTACATTTTATCCAGG + Intergenic
969615259 4:8248342-8248364 CTTTTGTTTACTCTTTTCCCAGG - Intergenic
970052929 4:11936738-11936760 CTTTTCTTTACAAATTACCCAGG - Intergenic
970196287 4:13553455-13553477 CCTTTGTGTACAATTTTCCATGG - Intergenic
971079189 4:23189459-23189481 TTTTTGTTTAAATTTGACCCAGG + Intergenic
971276517 4:25203003-25203025 CCATTATTTACATTTTGCCCAGG + Intronic
971285568 4:25285949-25285971 CCTTTGTCTACTTTTTAACAGGG + Intergenic
971573039 4:28238010-28238032 CCTTTGTTTCCATATAACTCTGG + Intergenic
973035462 4:45400421-45400443 CTTTCATTTACATTTTCCCCTGG + Intergenic
973663626 4:53135049-53135071 CATTTGTTTACATTTTAATCTGG - Intronic
975051249 4:69867496-69867518 CCTTTCTATACATTATACCAAGG - Intergenic
976561722 4:86509617-86509639 CAATTGTTTACATTTTAGCTGGG - Intronic
977073551 4:92423715-92423737 CCTCTGTTTGCATTTTATTCTGG - Intronic
978693947 4:111553190-111553212 CCTTTGTTTAAATATTAACAAGG + Intergenic
979825007 4:125221830-125221852 CTTTTCTTTACATTGAACCCAGG + Intergenic
981121858 4:141060574-141060596 CCTTTGTTTACATTTTACCCTGG - Intronic
982363480 4:154549861-154549883 CCGTTCTTTACATCTTTCCCTGG - Intronic
983159977 4:164400791-164400813 ACTTTTTTTGCATTTTTCCCCGG - Intergenic
984381856 4:179003266-179003288 TCTTTGTTAACATTTTAATCTGG - Intergenic
986026359 5:3854835-3854857 TCTTTGTTTAAATTTAAGCCGGG + Intergenic
986037312 5:3952510-3952532 CCTTTCTTTACATTAAACCAAGG + Intergenic
986709294 5:10476648-10476670 AATTTTTTTACATTTTACTCTGG + Intergenic
986937652 5:12910505-12910527 CCTTTCTCTACATTCCACCCTGG + Intergenic
988102376 5:26697498-26697520 CCTATGTTTAAATTTAACCAAGG + Intergenic
990623985 5:57591150-57591172 CCTTTATTTGCATTTTAACTGGG + Intergenic
993086926 5:83374641-83374663 ACTTTCATTACATTTTAACCTGG + Intergenic
994799368 5:104351747-104351769 GCTATGTTTACAATTTCCCCAGG + Intergenic
995295274 5:110513505-110513527 CCTTTGTTGACTTTTTACTTGGG - Intronic
995932944 5:117472284-117472306 CATTTGTTTACATTTTACATAGG + Intergenic
995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG + Intergenic
1000008031 5:157205484-157205506 CATTTGTTTACATTTTAAAGTGG + Intronic
1000174518 5:158737741-158737763 CTTTTCTTTGCATGTTACCCTGG - Intronic
1000450643 5:161382590-161382612 TCTTGCTTTATATTTTACCCTGG + Intronic
1000824431 5:166026924-166026946 CCTTTATTTTCATTTTGCTCAGG - Intergenic
1004804210 6:19184257-19184279 CTTTTGTTTATAAATTACCCAGG + Intergenic
1004810858 6:19260610-19260632 TCTCTGTTTACATTTTTTCCTGG - Intergenic
1004900725 6:20191329-20191351 CTATTGTTTACAATTTACCCGGG + Intronic
1005225038 6:23632831-23632853 CTTTTGTTTGCTTTTTACACAGG + Intergenic
1005733883 6:28726662-28726684 CCTGTATTTTCATTTTACACTGG - Intergenic
1007723562 6:43900668-43900690 CCTTTGTTTACAAATGATCCTGG + Intergenic
1009035172 6:58108721-58108743 ACTTTGTCTACATTTTACAAAGG - Intergenic
1009765392 6:68067379-68067401 GCTTTATTTAGATTTTACCAAGG - Intergenic
1013031355 6:106336251-106336273 CCCTCGTTTTCATTTTGCCCTGG - Intergenic
1013573868 6:111459587-111459609 CCTTTGCTTACATTTTAATGGGG - Intronic
1015282832 6:131452333-131452355 CTTTTATTTAAATTTTAACCAGG + Intergenic
1016655886 6:146517867-146517889 CCTTTATTTACATTTGTCCCTGG - Intergenic
1018535561 6:164815120-164815142 CTTTTGTTTATAAATTACCCAGG - Intergenic
1019034363 6:169041942-169041964 CCTGTGTTTCCTTTTTCCCCAGG + Intergenic
1020557384 7:9687867-9687889 CCTATGAATACATTTTACCAAGG - Intergenic
1021689428 7:23217719-23217741 CCTGTATTTTCATTTTGCCCTGG - Intergenic
1021946418 7:25732204-25732226 CCTTTCTTTTCCCTTTACCCTGG - Intergenic
1026295815 7:69051467-69051489 CTTTTCTTTATAATTTACCCAGG - Intergenic
1026730175 7:72904742-72904764 CCTTTCTTTATAAATTACCCAGG - Intronic
1027113801 7:75462368-75462390 CCTTTCTTTATAAATTACCCAGG + Intronic
1027286053 7:76646973-76646995 CCTTTCTTTATAAATTACCCAGG + Intergenic
1027495102 7:78878322-78878344 CCTGCGTTTTCATTTTACACTGG + Intronic
1029212981 7:98923795-98923817 TCTTTGTTAAAAATTTACCCAGG - Intronic
1030514901 7:110527151-110527173 ATTTTCTTTACATTTTAGCCTGG - Intergenic
1032265345 7:130366493-130366515 CATTTGTTTCCATTTCCCCCTGG - Intronic
1032430337 7:131855826-131855848 CCTTTCTTTACAAATTACCCAGG + Intergenic
1033769713 7:144536240-144536262 CCTTTGTCTACTTTTTAACAAGG + Intronic
1034869761 7:154673695-154673717 ACTGTGTTAACATTTTACCTAGG - Intronic
1035103255 7:156418579-156418601 CATTTTCTTACATTTTACCAAGG - Intergenic
1035729831 8:1846098-1846120 CCACTGTTAACATTTCACCCAGG + Intronic
1039056159 8:33538524-33538546 CCTTTGTTTAAATTTTTTGCAGG + Intergenic
1039247027 8:35620319-35620341 CCTTTGTTTGCCTTTAACACAGG - Intronic
1040586288 8:48745490-48745512 CCTTTGCTTACCTTTTTCCTGGG + Intergenic
1040759975 8:50828924-50828946 CTGTTGTTTACATTTTACAGAGG - Intergenic
1040859833 8:51987556-51987578 CCTGTGTTTTCATTTTGCACTGG - Intergenic
1043413519 8:80025001-80025023 TATTTCTTTACCTTTTACCCTGG - Intronic
1043883247 8:85568778-85568800 TCTTTGTTTACTTTTTCCCATGG + Intergenic
1046981854 8:120345198-120345220 CATTTTTTTACGTTTTACTCTGG - Intronic
1047167225 8:122452588-122452610 CCGTTATTTCCATTTTACTCAGG - Intergenic
1047560608 8:125984224-125984246 CCTTTTTTTATAAATTACCCAGG + Intergenic
1049063759 8:140296712-140296734 CCTATGTTTGCATTTTGCACTGG + Intronic
1049553010 8:143269338-143269360 CCATGGTTTTCATTTTCCCCAGG + Exonic
1051950638 9:22627342-22627364 TCTTGGGTTACATTTTACACAGG - Intergenic
1052122321 9:24732785-24732807 CCTATGTTTTCATTTTGCACTGG + Intergenic
1055328869 9:75161300-75161322 CCCAGGTTTACATTTTTCCCTGG + Intergenic
1055690312 9:78823124-78823146 CCTTTCTTTACATTAATCCCTGG - Intergenic
1190042877 X:47085543-47085565 CACTTGTATACCTTTTACCCGGG + Intronic
1192913040 X:75625260-75625282 CCTTTGTATAGATTCTTCCCTGG - Intergenic
1192944779 X:75954112-75954134 TCTGAGTTTACATTTTTCCCTGG + Intergenic
1193226909 X:78994415-78994437 CCTTTCTTTATATTTAACCAAGG + Intergenic
1193411450 X:81168397-81168419 ACTTTGTTTACCTTTTACTTTGG + Intronic
1193444465 X:81583224-81583246 CCTTTGTTTGCTTTTTAATCAGG - Intergenic
1193999041 X:88404178-88404200 CCTTTGTCTACTTTTTAATCAGG + Intergenic
1194423928 X:93713571-93713593 CTTTTCTTTACAAATTACCCAGG - Intergenic
1194554000 X:95335537-95335559 TCATTGTTTCCATTTCACCCTGG - Intergenic
1195101694 X:101561223-101561245 CCTTTGATCACATTTTAACTGGG - Intergenic
1195753146 X:108176948-108176970 CCTTTCTTTACAATTGATCCAGG + Exonic
1196513383 X:116541345-116541367 CCTTTGTTTACTTTTTAATGAGG + Intergenic
1196753940 X:119141642-119141664 CCTTTGTTAATTTTTTCCCCTGG + Intronic
1197749327 X:129953798-129953820 GCCTTGTTTAAATTTTACCACGG - Intergenic
1197958705 X:131980509-131980531 TCTTTGTTCACATTTATCCCAGG + Intergenic
1198168042 X:134077067-134077089 CCTTTTTCTACTTTTTACTCAGG + Intergenic
1199092531 X:143708608-143708630 CCTTTGTTTATAAATTACACAGG - Intergenic
1199104021 X:143840632-143840654 CCTTTGTTTGTAAATTACCCAGG - Intergenic
1199154333 X:144529101-144529123 CCTTTGTTCATATTTTAATCAGG - Intergenic
1201293523 Y:12444965-12444987 CCCTTGTTTACTGTTTACACTGG + Intergenic