ID: 981123390

View in Genome Browser
Species Human (GRCh38)
Location 4:141078183-141078205
Sequence GGTTAAGTACAGGCATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981123390_981123393 -5 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123393 4:141078201-141078223 TAACCATTCCCTCAGTGAATGGG 0: 1
1: 0
2: 0
3: 11
4: 183
981123390_981123401 28 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123401 4:141078234-141078256 AATGGTGACAGGGATGCCCTAGG 0: 1
1: 0
2: 0
3: 11
4: 191
981123390_981123394 -4 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123394 4:141078202-141078224 AACCATTCCCTCAGTGAATGGGG 0: 1
1: 0
2: 1
3: 17
4: 125
981123390_981123400 18 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123400 4:141078224-141078246 GTAAATTGTGAATGGTGACAGGG 0: 1
1: 0
2: 0
3: 9
4: 163
981123390_981123399 17 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123399 4:141078223-141078245 GGTAAATTGTGAATGGTGACAGG No data
981123390_981123392 -6 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123392 4:141078200-141078222 TTAACCATTCCCTCAGTGAATGG No data
981123390_981123398 10 Left 981123390 4:141078183-141078205 CCAAGAGATGCCTGTACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 981123398 4:141078216-141078238 TGAATGGGGTAAATTGTGAATGG 0: 1
1: 0
2: 0
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981123390 Original CRISPR GGTTAAGTACAGGCATCTCT TGG (reversed) Intronic
904295911 1:29519622-29519644 GGGTTAGTTCAGGCTTCTCTGGG - Intergenic
908826671 1:68139771-68139793 GGTAAAGTACAGGTATGTGTAGG + Intronic
910917961 1:92311665-92311687 CAGTAAGTACAGGCATATCTTGG + Intronic
917167806 1:172133018-172133040 GGACAACTCCAGGCATCTCTGGG - Intronic
917742929 1:177978941-177978963 AGCTAAGGATAGGCATCTCTGGG - Intronic
920366102 1:205449172-205449194 GGGTTAGCACAGACATCTCTAGG + Intronic
920905985 1:210168817-210168839 GGTTAAGGACAGGAATCACTAGG - Intronic
922588893 1:226757885-226757907 GTGTATGTACAGGCATATCTTGG - Intergenic
924309812 1:242728445-242728467 GTTTAAGGAGAGGAATCTCTAGG - Intergenic
1070818547 10:79340883-79340905 GGGTGAGTCCAGGCATATCTCGG - Intergenic
1079142726 11:17823533-17823555 AGGTAAGTGCAGGCATATCTGGG + Intronic
1083030868 11:59590848-59590870 TGTTAAATACAGCCATCTCCAGG + Intronic
1089664867 11:120012044-120012066 GCTTAAGCACAGGAAACTCTGGG - Intergenic
1089945478 11:122467592-122467614 CGTTAAGTGCAGGTATCCCTTGG - Intergenic
1090887309 11:130889989-130890011 GATACAGTACAGGCTTCTCTGGG + Intronic
1091015271 11:132045236-132045258 GGTTAAGTGCTGGCAGTTCTGGG + Intronic
1094259208 12:28472709-28472731 GATTGAGTACAGTCATCACTTGG + Intronic
1094637437 12:32240087-32240109 TCTTCAGTACAGGCATATCTTGG - Intronic
1097311180 12:58121372-58121394 AGTGAAGTACAGTCATCCCTCGG + Intergenic
1101203024 12:102456661-102456683 GGTTAATTAAATACATCTCTCGG - Intronic
1103315228 12:120048966-120048988 AGTTCAGTTCAGGCATTTCTTGG + Intronic
1110228069 13:73140615-73140637 TTTTAAGTAAAGGCATCTTTAGG + Intergenic
1110242171 13:73281485-73281507 CGTTAAGTACAGGTATCTTTGGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1126894245 15:53241319-53241341 TGTTAAGTCCAGGCAAATCTGGG - Intergenic
1127307929 15:57726479-57726501 TGTTGAATACAGGCATATCTTGG - Intronic
1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG + Intronic
1127973848 15:63983107-63983129 GGGGAAGTACAAACATCTCTGGG - Intronic
1132932274 16:2464741-2464763 AGGGAAGCACAGGCATCTCTGGG - Exonic
1137920746 16:52486037-52486059 GGTAAATGACAGACATCTCTTGG - Intronic
1144400308 17:14891359-14891381 GGTAAAGTAAAGGGATCTATGGG + Intergenic
1145213728 17:21036217-21036239 GGTGAAGCACAGGGATTTCTTGG + Intronic
1146759636 17:35465650-35465672 GTTTAAGAACAGGCAACACTGGG - Intronic
1148698436 17:49574849-49574871 GGTCAAGTCCTGGCATCCCTTGG - Intergenic
1149553615 17:57557720-57557742 GGTTTCGTTGAGGCATCTCTTGG + Intronic
1153773125 18:8431325-8431347 GGTATAGTACAGTCATCCCTTGG + Intergenic
1159190773 18:65039185-65039207 GATTGAGTACAGGCAGCTCTTGG - Intergenic
1159386286 18:67729387-67729409 CTGTAAGTACAGTCATCTCTTGG + Intergenic
1159979695 18:74763126-74763148 AGATAAGTAGAGGAATCTCTTGG + Intronic
1161441925 19:4296743-4296765 GGAGAGGAACAGGCATCTCTAGG + Intronic
1164676779 19:30106462-30106484 GGTTAAAGACATGCACCTCTTGG + Intergenic
1166283153 19:41808572-41808594 GGTGAGGTGCAGGCACCTCTGGG + Intronic
926789313 2:16554393-16554415 GATTAAGCACATGCATCCCTGGG + Intronic
930808978 2:55520576-55520598 CGTGAAGGACAGGCATCTCCGGG + Intronic
932116938 2:69059821-69059843 GGTTATCTACAGGCATACCTTGG - Intronic
934054013 2:88236599-88236621 GGTTAGTTCTAGGCATCTCTGGG + Intergenic
936233365 2:110723951-110723973 GGTGACATGCAGGCATCTCTGGG - Intergenic
939466623 2:142564116-142564138 TGTTGAGTGCAGGCATCTTTTGG - Intergenic
941740260 2:169028333-169028355 GGGGAAATACAGGCATCTCCTGG + Intronic
943289862 2:186055498-186055520 GCTTTAGAACAGGCATCTCTGGG - Intergenic
944666622 2:201964295-201964317 AGATAACTACTGGCATCTCTTGG + Intergenic
947370873 2:229444364-229444386 GGAAATTTACAGGCATCTCTGGG - Intronic
1169750312 20:8985783-8985805 TATGAAGTACAGTCATCTCTTGG + Intergenic
1171401392 20:24874939-24874961 GGTTGAGCCCAGGCCTCTCTGGG - Intergenic
1173977859 20:47200862-47200884 GGTTAAGAGCAGGCATTTTTTGG + Intergenic
1174940030 20:54916709-54916731 GATCAAGTACAGCCATCTCTAGG - Intergenic
1178577001 21:33802517-33802539 GTGTAAGTACACGTATCTCTGGG + Intronic
1179252704 21:39686160-39686182 GCTTAATTGCAGGCATCGCTGGG - Intergenic
1180709950 22:17832757-17832779 AGTTAAGTCCAGGCCTTTCTGGG - Intronic
1182862854 22:33575463-33575485 GTTTAAATACAAGCAGCTCTAGG + Intronic
1184755737 22:46514849-46514871 GGGTACGGACAGGCATCCCTGGG - Intronic
952455786 3:33470466-33470488 GGTTAAATAAAGGCATCTTCAGG + Intergenic
952741024 3:36734961-36734983 GGTTGAGTCCACCCATCTCTTGG - Intronic
957994234 3:87668427-87668449 TGTTAGGTACAAGCAGCTCTGGG - Intergenic
959505596 3:107153057-107153079 GGGTAAGTAGTGGCCTCTCTGGG - Intergenic
960604866 3:119495053-119495075 GGTTAAGTGTAGGGAACTCTTGG - Intergenic
965741686 3:171881831-171881853 GGAAAAGTACAGGGATCCCTGGG - Intronic
966224956 3:177588152-177588174 GGTTAACAACAGACATCTCTGGG - Intergenic
976622922 4:87147447-87147469 AGATAAGTACAGTCATCCCTTGG + Intergenic
981123390 4:141078183-141078205 GGTTAAGTACAGGCATCTCTTGG - Intronic
981907730 4:149941863-149941885 GGTTAAGAATAGTAATCTCTTGG + Intergenic
986202618 5:5591802-5591824 CCCTAAGCACAGGCATCTCTGGG - Intergenic
986308056 5:6530208-6530230 GATGAAGTACAGTCATCCCTCGG + Intergenic
987050905 5:14145281-14145303 GGTTTAGTACTGTCTTCTCTTGG + Intronic
992726382 5:79612085-79612107 GGTTAAAGAAAGGCTTCTCTGGG + Intergenic
996104351 5:119481448-119481470 CTTTAAATACAGGCATATCTTGG + Intronic
996849722 5:127938432-127938454 GGTTAACTAGAGCCATCTCCAGG + Intergenic
1000368922 5:160516553-160516575 GGAGAAGTACAGGGTTCTCTAGG - Intergenic
1001037397 5:168307274-168307296 GGTAAAGAACATGCATCTGTGGG - Intronic
1004998721 6:21219148-21219170 TAGTAAGTACAGTCATCTCTTGG + Intronic
1007326135 6:41061437-41061459 GGCCAAGTGCAGGCATCTCGGGG + Exonic
1009865736 6:69395514-69395536 GGTTAACAAGAGGCACCTCTTGG - Intergenic
1010115931 6:72310991-72311013 GCTTAAGTAAAGCCATCTTTTGG + Intronic
1012471728 6:99579975-99579997 TGTACAGAACAGGCATCTCTTGG - Intergenic
1013700237 6:112758986-112759008 TGTTAAGTGCAGGCATATTTAGG + Intergenic
1014536688 6:122622106-122622128 GTTTAAGTACAGCAATTTCTAGG - Intronic
1017130790 6:151106808-151106830 GGTTATGTACATGCATGTTTAGG - Intergenic
1018713049 6:166511059-166511081 GCTAAAGTACAGGCATCACCTGG - Intronic
1018950642 6:168376735-168376757 TTTAAAGTACAGGCATCTCTTGG + Intergenic
1026605415 7:71811612-71811634 GGAAAAGTACAGTCCTCTCTCGG - Intronic
1026658160 7:72275469-72275491 GGTTTATTACAAGCATCTCGGGG - Intronic
1032205126 7:129856876-129856898 GTTAAAATACAGTCATCTCTTGG - Intronic
1032374774 7:131401646-131401668 TGTTAATTATAGGCATATCTTGG + Intronic
1032570444 7:132990386-132990408 GGTCAAATGCAGACATCTCTGGG + Intronic
1034185432 7:149172756-149172778 AGGCAAGTACAGGCATCTCCAGG + Intronic
1037348773 8:17927025-17927047 GGAAAAGTACAGGCATATCTTGG + Intronic
1041211318 8:55554196-55554218 GGTTGAGTTTAGGCATCACTAGG - Intergenic
1041709586 8:60881658-60881680 GGTTAGGGAAGGGCATCTCTGGG + Intergenic
1045158358 8:99505835-99505857 GAATAAGTACAGGCATACCTCGG - Intronic
1048991163 8:139761040-139761062 GGTGCAGTACAGGCCTCCCTGGG + Intronic
1050287807 9:4121309-4121331 AGTTAACTTCAGGCATCTGTGGG + Intronic
1050495305 9:6234571-6234593 GGTACAGAACAGGAATCTCTGGG + Intronic
1051769701 9:20563746-20563768 GGTCAAGTACAGAAATCTGTAGG - Intronic
1057047689 9:91898664-91898686 GGTGATTTACGGGCATCTCTGGG - Intronic
1057646140 9:96877030-96877052 GTTTAAGTAGGGACATCTCTGGG - Intergenic
1060376845 9:123122900-123122922 GGTTAAGTACAGATATTGCTAGG + Exonic
1060594515 9:124840245-124840267 GGCTAAGTACAGGCAACTTGTGG - Intergenic
1186780471 X:12907154-12907176 GGTTAAGCTCAGGCTTCACTAGG - Intronic
1186813291 X:13211085-13211107 AGTTAATTACAGGACTCTCTTGG + Intergenic
1193370925 X:80696111-80696133 GTTTAAGTAAAGGCATTTCTAGG - Intronic
1193890658 X:87042070-87042092 GGTAAAGTTCAGGAATATCTGGG + Intergenic
1197945284 X:131831910-131831932 GTTTAAGTACACGCATGCCTGGG + Intergenic
1199341997 X:146691477-146691499 TATTATGTACAGGCATCCCTTGG + Intergenic
1201953559 Y:19593802-19593824 GGATAAGTAAAGGGATTTCTAGG + Intergenic