ID: 981125028

View in Genome Browser
Species Human (GRCh38)
Location 4:141095799-141095821
Sequence GAGAAAAATATAATCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981125026_981125028 -10 Left 981125026 4:141095786-141095808 CCTCTGGGAAGGGGAGAAAAATA 0: 1
1: 0
2: 2
3: 48
4: 479
Right 981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG 0: 1
1: 0
2: 3
3: 49
4: 487
981125019_981125028 27 Left 981125019 4:141095749-141095771 CCAAAAGAATTATTTAAAAACTT 0: 1
1: 1
2: 15
3: 143
4: 1421
Right 981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG 0: 1
1: 0
2: 3
3: 49
4: 487
981125018_981125028 28 Left 981125018 4:141095748-141095770 CCCAAAAGAATTATTTAAAAACT 0: 1
1: 1
2: 24
3: 208
4: 1814
Right 981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG 0: 1
1: 0
2: 3
3: 49
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981125028 Original CRISPR GAGAAAAATATAATCACTGA GGG Intronic
902523012 1:17032482-17032504 TAGAAAAATATAATTACTGCCGG - Intronic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
907080391 1:51616581-51616603 GAGAAAAACATAAGCAAGGAAGG - Intronic
907380976 1:54088418-54088440 GATAATAAGATAATCACTGGGGG - Intronic
907650240 1:56287868-56287890 GAGAACAATGTCATCATTGATGG + Intergenic
908583099 1:65538698-65538720 GAGAAGAAAAAAATCACTAAAGG - Intronic
908815168 1:68024321-68024343 CAGATAAACATAATCTCTGAGGG + Intergenic
909528005 1:76648987-76649009 GAGAAAATTAGAATTACTAATGG + Intergenic
909661110 1:78083628-78083650 GAGAAACATATAAGGAGTGATGG - Intronic
911385412 1:97169142-97169164 GAGCAAAACAGAATCACTGCTGG - Intronic
911833377 1:102583115-102583137 GAGAAAGAAATAATTGCTGAGGG + Intergenic
911951749 1:104182103-104182125 GAAAAAAATAAAATAACTTAAGG + Intergenic
912030941 1:105242695-105242717 GAGATAAATATAGTCACTTTAGG - Intergenic
913078177 1:115359322-115359344 GAGAAAAAAAAAATCATTGAAGG - Intergenic
913565773 1:120070576-120070598 GTGAAAAAACTAATCACAGAGGG + Intergenic
913632356 1:120722978-120723000 GTGAAAAAACTAATCACAGAGGG - Intergenic
913658224 1:120982103-120982125 GAGGAGTATATAATCTCTGATGG - Intergenic
913706211 1:121425914-121425936 GAGAAAAAAATATTCCCTGTAGG + Intergenic
914009582 1:143765192-143765214 GAGGAGTATATAATCTCTGATGG - Intergenic
914350816 1:146838501-146838523 CTGAAAAATATAATAACTTAAGG - Intergenic
914522800 1:148433388-148433410 GAGGAGTATATAATCTCTGATGG - Intergenic
914648206 1:149673867-149673889 GAGGAGTATATAATCTCTGATGG - Intergenic
915431331 1:155869147-155869169 GTGAAAAATAAATTCACTGGAGG - Intronic
915706126 1:157845591-157845613 AAGAAAAATCCAATCACTCACGG + Intronic
916830110 1:168482211-168482233 GAGAAGAATACAGTCACAGATGG - Intergenic
918386780 1:184016114-184016136 GAGATAAATTTAATAACTAAGGG - Intronic
918805838 1:189042798-189042820 GGAAATAAAATAATCACTGAAGG + Intergenic
919260320 1:195184498-195184520 CAGAAAAATGCAATCACTTAAGG + Intergenic
919264382 1:195242727-195242749 GTAAAAAATATAGTCACTGAAGG - Intergenic
919980355 1:202639038-202639060 GTGAAAAAAATAATCCCAGATGG - Intronic
920827100 1:209432365-209432387 GAGAGAAATGTGATCAATGAAGG + Intergenic
922083553 1:222323365-222323387 AAGACAATCATAATCACTGATGG - Intergenic
922349886 1:224726636-224726658 GAGTAAAACCTAATCACTTATGG - Intronic
923199763 1:231699979-231700001 GAGAAAAATATTCCCACAGAGGG - Intronic
924692045 1:246361968-246361990 GAGAAAAAAATAATAACGCATGG + Intronic
1063322425 10:5062967-5062989 GAGAAAAAAATAATGAATCAGGG - Intronic
1063585442 10:7348335-7348357 TACAAAAAAATAATCACAGATGG + Intronic
1063617116 10:7610018-7610040 GAGAAAAATGTAATCAGGGAAGG - Intronic
1064064469 10:12169222-12169244 GAAAAAAATAGAATAAGTGAGGG - Intronic
1064079036 10:12293535-12293557 GAAAAAAATATATCAACTGAAGG + Intergenic
1065193958 10:23243375-23243397 ATGAAAAATTTTATCACTGATGG - Intergenic
1067325459 10:45261596-45261618 GGGAGAAATATAATCAGAGATGG + Intergenic
1067365778 10:45627280-45627302 CAGAAAAGTATACTCAGTGAAGG - Intronic
1067680532 10:48434787-48434809 GAGAAAAAAATTACCACTGGAGG + Intronic
1068471495 10:57470210-57470232 GAGAAATATATAATAATAGAAGG + Intergenic
1070061097 10:72983801-72983823 GAGAAAAAAAAAACAACTGATGG - Intergenic
1071285176 10:84137966-84137988 GAAAAAAAGACTATCACTGAAGG + Intergenic
1072096785 10:92189826-92189848 GAAAAAAAAAAAATCACTGGAGG - Intronic
1072378649 10:94842590-94842612 GAGAAAATTATTATCAATAAAGG - Intronic
1073409588 10:103329426-103329448 GAAAAAAATATAACCAGTAACGG + Intronic
1073771166 10:106737350-106737372 CAGAAAAATGCAAACACTGATGG - Intronic
1073952364 10:108824920-108824942 GAGAACACTATAATAACTTATGG - Intergenic
1074066878 10:110023527-110023549 AAGAAATATATAGTCACTGAGGG + Intronic
1074588526 10:114790642-114790664 GAGAAAAATAAAATGATTCATGG - Intergenic
1074646808 10:115463394-115463416 TAGAAACAGATAATCAGTGAAGG - Intronic
1074752129 10:116596649-116596671 GAGCAAAACATAATCAAGGAGGG + Intronic
1074953823 10:118367670-118367692 GAGAAAAGTAAAATCAGAGAAGG - Intergenic
1075185025 10:120248223-120248245 GGGAGAAATTTAATCACTGGAGG - Intergenic
1075227598 10:120643765-120643787 CTGGAAAATAAAATCACTGAAGG + Intergenic
1075884935 10:125891714-125891736 GAGGAAAATATAATCATTTTGGG + Intronic
1079599862 11:22298196-22298218 AAGGAAAATTTAAGCACTGATGG + Intergenic
1079601026 11:22313658-22313680 GAGAAAAATATGATAAGGGAGGG + Intergenic
1081060740 11:38472805-38472827 GAGAAAAAAATAAAAAATGATGG - Intergenic
1081186879 11:40053828-40053850 AAGAAAAAAATAGTCACGGAAGG - Intergenic
1081326851 11:41755304-41755326 TAGAAAAATATATTCAAGGAAGG - Intergenic
1081972415 11:47208749-47208771 GAGAAAAACATCATCACAGCCGG - Intergenic
1082116486 11:48335286-48335308 GAGGAGTATATAATCTCTGAGGG - Intergenic
1082257305 11:50045032-50045054 GAGGAGTATATAATCTCTGAGGG + Intergenic
1082700301 11:56421601-56421623 TAGAAAAATATATTCAATAACGG + Intergenic
1085558550 11:77448487-77448509 GAGTAACACATAAACACTGAAGG + Intronic
1085585606 11:77701778-77701800 GACAGAAATATCATCACGGAGGG - Exonic
1087386618 11:97478333-97478355 CATAAAAATATTCTCACTGAAGG + Intergenic
1087517832 11:99187213-99187235 GAGAAAATTACAATCAAAGATGG + Intronic
1089074361 11:115726385-115726407 AAGAATAATAAAATCACAGAAGG - Intergenic
1089228984 11:116953521-116953543 GAGGAAAATATAGCTACTGAAGG + Intronic
1089437975 11:118487516-118487538 GAGAAACATATTAACACTTAGGG - Intronic
1090228629 11:125086222-125086244 GAGGAAAATACTATCACTGGTGG - Exonic
1090963371 11:131576625-131576647 AAGAAAAATATAATCTCTAATGG + Intronic
1092977606 12:13760398-13760420 TGGAAAAATATAATCACAGTTGG - Intronic
1093985919 12:25533221-25533243 GAGAAAAAGATAACTACTAAAGG - Intronic
1094715066 12:33005612-33005634 AAGAAAAACAAAATCTCTGAAGG - Intergenic
1094740882 12:33287116-33287138 CAGAAAAATCTCTTCACTGAAGG - Intergenic
1094744582 12:33329986-33330008 GAGAAAGATAAAATCAGTTATGG + Intergenic
1096351524 12:50904915-50904937 GAGAAAAATATGATAAGGGAGGG + Intergenic
1097767012 12:63537614-63537636 GAAAAAAACAGAAACACTGAAGG + Intergenic
1097783361 12:63732559-63732581 GAAAAAAACAGAAACACTGAAGG + Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1099082433 12:78202550-78202572 GGCAAAAGTATAATCACTTAAGG + Intronic
1099189486 12:79547770-79547792 GAAAAAAATGTTTTCACTGAGGG + Intergenic
1099572625 12:84343710-84343732 CAAAAAAATAGAATCAATGAAGG - Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1100098685 12:91076087-91076109 GAGAAAAAGATATTGAATGATGG + Intergenic
1100343098 12:93700424-93700446 AAGAAAAAAAAAATTACTGAAGG - Intronic
1100642619 12:96496791-96496813 GAGACATATATAATTTCTGAGGG + Intronic
1100996824 12:100309915-100309937 GAGAAAAAAATAATAACTGCTGG - Intronic
1101129798 12:101677206-101677228 GAAAAAAAAATAATAACTGGAGG - Intronic
1101572476 12:105966538-105966560 GAGAAAAATAAAAGCAGGGATGG - Intergenic
1102091958 12:110198130-110198152 GAGTAAAATACAAGCAGTGATGG - Intronic
1102775145 12:115512143-115512165 ATGAAAAACAAAATCACTGAAGG - Intergenic
1103120385 12:118375400-118375422 GAGATAAATTTAATCACAAAAGG + Intergenic
1103170410 12:118813921-118813943 GAGAAAAAGAAAAGGACTGAAGG - Intergenic
1103814416 12:123642152-123642174 AAGAAAAAGAAAATAACTGAAGG - Intronic
1104207129 12:126649948-126649970 GACAAAAATATAATCCTTGAAGG - Intergenic
1105784575 13:23735651-23735673 GAGAAAAATATATACACTTGTGG + Intronic
1106207083 13:27609139-27609161 AAGAAAAAAAAAATCACTGTTGG - Intronic
1106645247 13:31627314-31627336 AAGAAAAATATACTTCCTGAAGG + Intergenic
1106679110 13:31992012-31992034 GAAAAAAATGTAATCAATGCTGG - Intergenic
1107059093 13:36136190-36136212 AAGAAAAGGAAAATCACTGAAGG + Intergenic
1107305857 13:39018260-39018282 GAGAAAAATTTAACCTCTTATGG + Intronic
1107603556 13:42038044-42038066 CACAAAAATATAATAACTCAAGG + Intergenic
1107649358 13:42528519-42528541 GAAACACATATAATCCCTGAAGG + Intergenic
1107727315 13:43311984-43312006 AAGAAAAATAAAATCTCTCATGG + Intronic
1108315501 13:49233140-49233162 AAGAAAGATGTAATAACTGAAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108403812 13:50080734-50080756 GGGAAAAAAAAAATCACCGAAGG + Intergenic
1108639820 13:52372618-52372640 AAGAAAAAAATAGTTACTGAAGG - Intergenic
1109246318 13:59958126-59958148 TGGAAAAATTTTATCACTGAGGG - Intronic
1109872493 13:68352209-68352231 GAGAGAATGAGAATCACTGAGGG - Intergenic
1110496700 13:76176005-76176027 GAGAAACAAAGAATCACTGGAGG - Intergenic
1110543969 13:76736323-76736345 GAGTTAAATATAATCTCTCAGGG + Intergenic
1110644488 13:77866737-77866759 TAGAAAAATATACTCACTTTTGG + Intergenic
1111020809 13:82447791-82447813 GAGAATAAAATCTTCACTGAAGG + Intergenic
1111170390 13:84519521-84519543 GAAAAAAATACAATTTCTGATGG + Intergenic
1111664276 13:91247343-91247365 GAGAAAAATCTCATTACTAAAGG + Intergenic
1112224402 13:97523782-97523804 GAGAGGAATAAAAACACTGATGG + Intergenic
1112597331 13:100819763-100819785 GAAAAAAAAATGATCACAGAAGG + Intergenic
1113082212 13:106532348-106532370 GAAACAAATCTAATTACTGATGG + Intronic
1113099512 13:106702143-106702165 GAGACAAATTTAGACACTGATGG + Intergenic
1113901233 13:113799313-113799335 GAGAAACAGATAAACACAGATGG - Intronic
1114071694 14:19114980-19115002 GATTAAAAAATTATCACTGAAGG - Intergenic
1114090567 14:19284984-19285006 GATTAAAAAATTATCACTGAAGG + Intergenic
1114241363 14:20871426-20871448 GAGAAAAATATGATTACCAAGGG + Intergenic
1114691048 14:24582001-24582023 GAGAAAAAAATTATAACTGACGG - Intergenic
1114763352 14:25343261-25343283 GGGAAATATAACATCACTGAAGG - Intergenic
1114850458 14:26377142-26377164 GAGAAGAGTATAATCACACATGG - Intergenic
1114903506 14:27097319-27097341 AAGAAAAAAAAAGTCACTGATGG - Intergenic
1115208592 14:30941513-30941535 GAGAAAACAAAAATCACTGGTGG + Intronic
1115701933 14:35962134-35962156 GAGGCAATTATTATCACTGATGG - Intergenic
1115723811 14:36191439-36191461 GGGGAAAAAAAAATCACTGAAGG - Intergenic
1116260762 14:42622225-42622247 GGAAAAAATATAATTGCTGAAGG - Intergenic
1116295516 14:43101768-43101790 AAGAAAAAAAAAATCACGGATGG + Intergenic
1116333289 14:43622868-43622890 GATAGAAATTTTATCACTGAGGG - Intergenic
1116446905 14:45021473-45021495 GAGAAAAATATGATAAGGGAGGG + Intronic
1116503341 14:45647810-45647832 GAGAAAAATATAAGCACAGAGGG - Intergenic
1117125719 14:52622911-52622933 GTGAAGAATATAGTCACTGCCGG + Intronic
1117147195 14:52847146-52847168 GAGAATACTATATTCAGTGAGGG - Intergenic
1117584312 14:57184601-57184623 GAGAAAAAAGAAATAACTGAAGG - Intergenic
1117697267 14:58378332-58378354 TGGAAAAAAAAAATCACTGATGG - Intergenic
1118087760 14:62438270-62438292 GAGAACAATATAATAACAGTGGG - Intergenic
1118447878 14:65868170-65868192 GAGCAATATAAAACCACTGAAGG + Intergenic
1120836596 14:89043567-89043589 GAAAAACAGATATTCACTGAAGG + Intergenic
1121257939 14:92544886-92544908 GAGAAAAATAGGATCAGGGAGGG - Intronic
1122148378 14:99707746-99707768 AAAAAAAAAAAAATCACTGAAGG - Intronic
1202873101 14_GL000225v1_random:182234-182256 GAGGAAAATATAATCATTTTGGG - Intergenic
1124044109 15:26132170-26132192 GAAAATAACATAATCACTGAAGG - Intergenic
1124460528 15:29886266-29886288 AATAAAAATTTAATGACTGATGG - Intronic
1124919454 15:34011725-34011747 GAGAAAGATATAAGGACTTAGGG - Intronic
1126409493 15:48357408-48357430 CAGAAACATGAAATCACTGAAGG + Intergenic
1127035396 15:54910721-54910743 GAGAAAAATATCTTCACTAGAGG + Intergenic
1127073740 15:55306856-55306878 GAGAAAAATACAATAAGGGAGGG + Intronic
1127173267 15:56326360-56326382 TAGACAAATATATTTACTGAAGG + Intronic
1127520314 15:59737284-59737306 AAGAAAAAGATATTCACAGATGG - Intergenic
1128816221 15:70610579-70610601 TAGGAAAAGATAATCCCTGAAGG - Intergenic
1130363176 15:83208533-83208555 GAGAGAAACATAATCGCTTATGG - Intergenic
1130835256 15:87644124-87644146 GAGAAAAATATTCTCACAGCGGG - Intergenic
1132246819 15:100303639-100303661 GATACAAATATAATCACATATGG - Intronic
1133709321 16:8385903-8385925 GAGAAAAAAATCATCCCTGAGGG + Intergenic
1135172951 16:20202579-20202601 CATAAAAATATACTCTCTGAGGG + Intergenic
1136969673 16:34959792-34959814 GAGTCAAATGGAATCACTGAAGG - Intergenic
1137396780 16:48121715-48121737 GAGAAAAGTATGATCACCAAAGG - Exonic
1139449933 16:67021421-67021443 GAGAGAAAGAAATTCACTGAAGG + Intergenic
1139983219 16:70877043-70877065 CTGAAAAATATAATAACTTAAGG + Intronic
1141708865 16:85685924-85685946 GAAAAAAAAAAAATCACTCAGGG + Intronic
1143206684 17:5146211-5146233 GAGAAAAATGTCATCTTTGAAGG - Intronic
1144175310 17:12699422-12699444 GAGAAATATATGATCAAAGAAGG - Intronic
1145917461 17:28583803-28583825 GAGAAAAAAATAAGCACTTAGGG + Intronic
1146344001 17:32044998-32045020 CAGACAAAGATTATCACTGATGG - Intronic
1146416266 17:32636049-32636071 GGGAAAAAGAGAATCACTGAAGG - Intronic
1146997609 17:37334670-37334692 GAGAAAAATATGATAAGGGAGGG - Intronic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147937355 17:44020185-44020207 GAGAGAAATATTATCCCAGATGG + Intronic
1149054401 17:52345630-52345652 GAGAAAATTACATTCACTAAAGG - Intergenic
1149225121 17:54461229-54461251 GAGAAAATGATACTCACTAATGG + Intergenic
1150087502 17:62285260-62285282 GAGAAAAATGTCATCTTTGAAGG + Intergenic
1150947267 17:69761598-69761620 ATGAAAAATATAATAATTGAGGG + Intergenic
1152015474 17:77747704-77747726 CAGAAAAATAAAAGCCCTGATGG - Intergenic
1153158691 18:2178673-2178695 GATAAAAATAGAACCACAGAAGG - Intergenic
1155260949 18:24041891-24041913 GAGAAAAATGTAATCACGCCGGG - Intronic
1155981355 18:32183613-32183635 GAGAAAAAAAAAAAGACTGAGGG - Intronic
1156378828 18:36538955-36538977 AAGTAAGATATAATCACTGAGGG + Intronic
1156644801 18:39148093-39148115 GAGGAGTATATAATCTCTGAGGG - Intergenic
1156897658 18:42264923-42264945 GAGAAAAATATAAACAATGTAGG + Intergenic
1157523537 18:48361805-48361827 GAGGAAAAGACAATCCCTGAAGG + Intronic
1158183790 18:54748243-54748265 GATAAAGATATAAGCACTAAAGG + Intronic
1158868131 18:61657908-61657930 GAAAAAAAAATAATCCCTAAAGG + Intergenic
1159375618 18:67588747-67588769 TAGAAAAATAAAAACACAGAGGG - Intergenic
1159691435 18:71493404-71493426 CAGAATAATATCATCAATGAGGG - Intergenic
1159809367 18:72998337-72998359 GAGATAATTATAATTACAGATGG + Intergenic
1159933252 18:74336383-74336405 GAGAAAAAGAAAATGTCTGAGGG + Intronic
1160109622 18:76013866-76013888 GAGGAAAATACAGACACTGAAGG - Intergenic
1161653620 19:5499504-5499526 AAGAAAACTGTAATCACTGCGGG + Intergenic
1161990908 19:7683638-7683660 CTGAAAAATATAATAAATGAGGG - Exonic
1163245614 19:16092195-16092217 AAGAAAAGTATAATTTCTGATGG + Intronic
1164128930 19:22344331-22344353 AAGAAAACTACAATCACTCAGGG - Intergenic
1164170490 19:22720694-22720716 AAGAAAACTAAAATCACTCAGGG + Intergenic
1165237952 19:34438605-34438627 GAGAAAAATTTACTCCATGATGG - Intronic
1165280665 19:34794537-34794559 GAGGAGTATATAATCTCTGAGGG - Intergenic
925131978 2:1500498-1500520 GATAAGAATATAAGCACTCAAGG + Intronic
926456712 2:13075658-13075680 GAGGAATATCTAATCTCTGAGGG + Intergenic
926538985 2:14151356-14151378 AACAAAAATTTAATAACTGATGG - Intergenic
926666666 2:15531906-15531928 GGGAAAAAAATAATCAGAGATGG - Intronic
926782123 2:16482923-16482945 CAGAAAAATAAAAGCACAGAGGG + Intergenic
927046830 2:19287451-19287473 GAGAAAAAAATCATGCCTGAGGG + Intergenic
927912572 2:26911909-26911931 GGGAAAAATATATTCTTTGATGG - Intronic
929041773 2:37751392-37751414 GTGAAAATAATAATAACTGAGGG + Intergenic
929170692 2:38930160-38930182 TAAAAAAAGAAAATCACTGATGG - Intronic
930257818 2:49111836-49111858 GAGTAAGAAATAATTACTGAGGG - Intronic
930466805 2:51763533-51763555 AAGAGAAATATCACCACTGAAGG + Intergenic
930773594 2:55151518-55151540 CAGAAAAAGATAAGCGCTGATGG + Intergenic
931706899 2:64953870-64953892 GTGAAGAATATAATCAGTCAAGG + Intergenic
931997795 2:67855796-67855818 GAGAAACATACAGTCAATGATGG - Intergenic
932302816 2:70678970-70678992 GACAAAAATAGAACCACTTATGG + Intronic
932891084 2:75598014-75598036 AAGTAAAATATAATAACTGGGGG - Intergenic
933177198 2:79188607-79188629 GAGAGAAGAAAAATCACTGAAGG + Intronic
933438557 2:82280778-82280800 GGAAAAAACATAATCACTTATGG + Intergenic
934521434 2:95022546-95022568 GAGAAAAATAAAATCCCTAGGGG + Intergenic
935617382 2:105100740-105100762 GAGTAGAATGTAATCACTGGGGG - Intergenic
935806835 2:106757188-106757210 GAGAAAAAAATTATCCCAGATGG + Intergenic
936685812 2:114825185-114825207 GAGAAATATATAGTCACTCTCGG - Intronic
937400012 2:121574332-121574354 AAAAAAAAAAAAATCACTGATGG + Intronic
937706380 2:124925555-124925577 GAGAAAAATATTGCCCCTGATGG - Intergenic
937766682 2:125669408-125669430 GAAAAAATTGTAATAACTGAGGG + Intergenic
939666436 2:144957875-144957897 GAGAAGAATGTAATAATTGATGG + Intergenic
940192568 2:151058105-151058127 GAGAAAATAATAATCACGAAGGG - Intergenic
940904769 2:159159104-159159126 AAGAAAAATAAAATCAGTGTCGG - Intronic
940975939 2:159944362-159944384 TAGAAAATTCTAGTCACTGATGG - Intronic
941376149 2:164733311-164733333 TAGATAAATAAAATGACTGAGGG - Intronic
941619098 2:167756719-167756741 GGGAAAAACATAATCACTGCAGG + Intergenic
941829061 2:169934067-169934089 GATAAAAATATATTCCCTCAAGG - Intronic
942424377 2:175843862-175843884 AACAAAAATAAAAGCACTGATGG - Intergenic
942443133 2:176056690-176056712 AATAAAAATAAAATCACGGATGG - Intergenic
942535149 2:176955586-176955608 AAGAAAAATAAAATCACTGAAGG + Intergenic
942919698 2:181356924-181356946 GAGAAAACTGAAATCACTTATGG - Intergenic
942925154 2:181423115-181423137 GAGAAACATCTATTCTCTGAGGG - Intergenic
942969150 2:181936295-181936317 TAGAAAAATGTAAACATTGATGG + Intergenic
943167282 2:184345867-184345889 ACGTAAAATATAATCACTGTAGG - Intergenic
943363926 2:186951447-186951469 AAAAAAAAAAAAATCACTGAAGG - Intergenic
943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG + Intergenic
943847117 2:192664971-192664993 TAGAAAAATATAATAACTAAGGG - Intergenic
943876590 2:193073907-193073929 GAAAAAAATATAATAACATAAGG - Intergenic
944736732 2:202573763-202573785 GACAAAATAATAAGCACTGAGGG + Intergenic
945508000 2:210665296-210665318 AAGAAAAAAAAAACCACTGATGG - Intronic
946651826 2:221899616-221899638 GAGAAAAGTGTAATAACTAATGG + Intergenic
947408126 2:229802634-229802656 GAAAAAAATATAAAAACTAAAGG + Intronic
947516920 2:230814093-230814115 GACAAAAAGACAGTCACTGAAGG + Exonic
1169599192 20:7237492-7237514 GAAAAACATAGAATGACTGAAGG + Intergenic
1169738575 20:8865178-8865200 GAGAAAGAGATAAACATTGATGG + Intronic
1170718195 20:18850427-18850449 GTTAAAAATATATTTACTGATGG - Intergenic
1170771229 20:19334499-19334521 GTGAAAAAGATGATCACTTATGG - Intronic
1171397168 20:24842850-24842872 GAGGAAAATAGATTCACAGAGGG + Intergenic
1172292611 20:33787258-33787280 GAAAAAAATATAATCCCTACTGG - Intronic
1173908922 20:46649780-46649802 GAGAAAAACACAATAAATGATGG - Intronic
1174232543 20:49058096-49058118 AAGAAAAAAAAAATCACTGGAGG - Intronic
1174998334 20:55598227-55598249 GACAAAAATATATTAACTTAAGG - Intergenic
1175668520 20:60880867-60880889 AACAAAAATATAAACACAGAAGG + Intergenic
1177345837 21:19868717-19868739 GAGAAAAGTAGAATTTCTGAAGG + Intergenic
1177598146 21:23273862-23273884 AAGAATAATATATTCACTGAGGG - Intergenic
1177827394 21:26099360-26099382 AAGAAAAATGTCATAACTGAGGG + Intronic
1178516456 21:33251602-33251624 CAGAAAAACATCATTACTGAAGG + Intronic
1178613859 21:34112851-34112873 GAGAAACACAAAACCACTGAGGG + Intronic
1178785679 21:35651216-35651238 GACAAAAAAATAATCATTTAAGG + Intronic
1178859777 21:36279109-36279131 GAGATAAAGAAAATCACTCAGGG + Intronic
1178967223 21:37132254-37132276 GAAAAAAATATATTTACTGAAGG - Intronic
1180284990 22:10737284-10737306 GAGGAAAATATAATCATTCTGGG + Intergenic
1180490133 22:15837331-15837353 GATTAAAAAATTATCACTGAAGG - Intergenic
1181122171 22:20678272-20678294 GAGAAAAAGATCATCAATGAAGG + Intergenic
1182493944 22:30693661-30693683 GAAAAAAAAAAAATCACTGATGG + Intergenic
1182878517 22:33713035-33713057 GAGCAAAATCCCATCACTGAAGG + Intronic
1182924137 22:34106941-34106963 GAGAAAAATAAAATCAGGAAAGG + Intergenic
1184314371 22:43672749-43672771 AGGAAAAATATAATAACTAATGG + Intronic
1203291892 22_KI270736v1_random:2762-2784 CAGAAAAAAATAGTCACTTATGG - Intergenic
1203293995 22_KI270736v1_random:22912-22934 GTGAAAATAATAATAACTGAGGG + Intergenic
949375197 3:3381223-3381245 GAGAAAGATTCAATTACTGAAGG + Intergenic
949553547 3:5132556-5132578 GAGAACAAGATAATTTCTGATGG - Intronic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
949902295 3:8826426-8826448 GAGAAAAATGTAATCAGAGCGGG + Intronic
951072507 3:18348805-18348827 GAGGAAATCATAATCACAGAAGG + Exonic
951691992 3:25406311-25406333 CAGACAAATACAATCCCTGATGG - Intronic
951838211 3:27005036-27005058 GAGAAAAATATGATAAGGGAGGG - Intergenic
953962496 3:47277730-47277752 GAAGAAAATATAATAAATGAAGG - Intronic
954321003 3:49832005-49832027 GAGATCAATATCATCACGGAAGG + Exonic
954343167 3:49972283-49972305 GTGCAAAATATTAACACTGAGGG - Intronic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
956070652 3:65446954-65446976 GAGATAAAGATAATCAGTCATGG - Intronic
956271791 3:67455683-67455705 GAGGAAAAAAAAAACACTGATGG + Intronic
956562057 3:70590058-70590080 GAGAAAAATAGAATGTCAGAAGG - Intergenic
957796173 3:85010713-85010735 GAGAAAAAAAAAATCACCTAAGG - Intronic
958629505 3:96668803-96668825 GAGAAAAATATGATAAGGGAGGG + Intergenic
958760990 3:98308310-98308332 TGGAAAAATATAATAACTAATGG - Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
960008767 3:112810493-112810515 GAGAAATATATGACCACTAAAGG - Intronic
960053273 3:113257670-113257692 AAGAAAATTATAATGACTGTTGG - Intronic
960509854 3:118536351-118536373 GAGAAAGATATAAGCCATGATGG + Intergenic
960791671 3:121438604-121438626 GAGAAAAAGACAATCACAAAAGG - Intronic
962060149 3:131917646-131917668 GAGAAATGCATATTCACTGAAGG + Intronic
962352285 3:134664901-134664923 GAGAAAAATATCTTCACTGGGGG - Intronic
962579322 3:136783577-136783599 AAGAAAAAGAAATTCACTGATGG + Intergenic
963265545 3:143236748-143236770 AAGAAAATTATAAGCACTGGTGG - Intergenic
963759187 3:149269219-149269241 GAGAAAAAGAAAACCACTCACGG - Intergenic
963797351 3:149644255-149644277 GAGATCATTTTAATCACTGAAGG - Intronic
964401118 3:156299707-156299729 AAGAAAAAAAAAATCACTGCTGG - Intronic
964799361 3:160537764-160537786 GAGAGAAAAATAATCAAGGATGG - Intronic
965187286 3:165481787-165481809 GATAGAAATATAAACACTAAAGG + Intergenic
965824604 3:172718037-172718059 GAGACTAAACTAATCACTGAGGG - Intergenic
965944417 3:174223066-174223088 GAGATATATAAAATCCCTGACGG - Intronic
967595441 3:191322608-191322630 CAGAAAACTATAATAGCTGAAGG + Intronic
967675632 3:192295585-192295607 GAGCTAAATATAATCACAGCAGG + Intronic
967706661 3:192659153-192659175 CAGAAAATTATAACTACTGAGGG + Intronic
968345537 3:198002127-198002149 GAGAAAAAAGAAAGCACTGATGG - Intronic
969200425 4:5599873-5599895 GAGGAAAGTAGATTCACTGATGG + Intronic
969352444 4:6605549-6605571 TAGAAAAAAATGAGCACTGAGGG + Intronic
970127203 4:12828221-12828243 GAGAAAAAAATAATCAAGGACGG - Intergenic
971560107 4:28068380-28068402 GAGAAAAAAGTAATCCCAGAAGG + Intergenic
972325406 4:38010767-38010789 GAGAAAGAACTAAGCACTGAAGG - Intronic
972463916 4:39333855-39333877 GAGAAAAATTTAATTACACATGG + Intronic
972733606 4:41818773-41818795 GAGAAAAATACAATCTCTGTGGG + Intergenic
972992473 4:44837679-44837701 GAGAAAAATAGAATGACCGATGG - Intergenic
973587059 4:52403940-52403962 GAGAAAAATAGATTCACAGTGGG - Intergenic
974347692 4:60703205-60703227 GAGAAAACTGAAATGACTGATGG - Intergenic
975313505 4:72928082-72928104 GAGAAAAATATGATAAGGGAGGG + Intergenic
975872093 4:78791006-78791028 GAGAAAAATCAAATAACTGATGG - Intronic
976417494 4:84795269-84795291 TAGAACAATTTCATCACTGAAGG + Intronic
976573620 4:86641975-86641997 GACAAAAATATAATCATAGTGGG - Intronic
976727868 4:88232653-88232675 CAGAAAAAAAAAATCCCTGACGG - Intergenic
976982329 4:91246412-91246434 GAGAAAATAATCTTCACTGAAGG + Intronic
977205472 4:94160701-94160723 GATATAATTATAATCACTAAAGG + Intergenic
977495811 4:97774057-97774079 GGGAGGAATATAATTACTGAAGG - Intronic
977785070 4:101023268-101023290 GAGAGAAACCTAATAACTGATGG + Intergenic
977850872 4:101826866-101826888 GATATAAATATTATCTCTGAGGG - Intronic
978045513 4:104121522-104121544 GATAAAAATATAATAACTGCTGG + Intergenic
978586243 4:110278901-110278923 GAGAAAAATATGATAAGGGAGGG + Intergenic
978724966 4:111958854-111958876 GACAAAAATGTAAACACTCATGG - Intergenic
978886726 4:113773536-113773558 AAGTAAAATATATTCAATGAAGG - Intergenic
979190563 4:117851433-117851455 GAGAAAAATATCATCTATAAAGG + Intergenic
979570742 4:122221254-122221276 AAGAAAAATATAGTCAGTGATGG - Intronic
979765071 4:124454748-124454770 GATATAACTATAATCAGTGACGG - Intergenic
980468996 4:133226383-133226405 GAGTAAAACATAATCAATAATGG + Intergenic
980871764 4:138620052-138620074 GAAAAAAACATAGTGACTGAGGG + Intergenic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
981302886 4:143209849-143209871 GAGAAAAATATAAAAACTTAGGG - Intronic
981520555 4:145657413-145657435 CAGTACAATATAATCACAGATGG - Exonic
981587199 4:146316861-146316883 GAGAAAAATAGAATCCCTGGAGG - Intronic
981714791 4:147742243-147742265 AAGAAAAATGTAGGCACTGAAGG - Intronic
982371775 4:154641472-154641494 GAGCAAATTAAAATCTCTGAGGG - Intronic
982432247 4:155336351-155336373 GAAAAAAATAGAATCAGGGATGG - Intergenic
982618639 4:157675786-157675808 TAGTAAAACATAATCACTGATGG + Intergenic
983081766 4:163394344-163394366 GAAGAAACTACAATCACTGAAGG - Intergenic
983124119 4:163929365-163929387 GAGAACAAAAAAATCAATGAAGG + Intronic
983188105 4:164723976-164723998 GAGTAAAACAGATTCACTGAGGG + Intergenic
983426047 4:167584244-167584266 GAGGTAAATATAATCAATCAGGG - Intergenic
983599362 4:169507714-169507736 CAAAAAAATCGAATCACTGAAGG - Exonic
983727948 4:170953587-170953609 GAGAAAAAAATAAAAAATGATGG - Intergenic
984530655 4:180911949-180911971 GAGGAAAACATAAGAACTGACGG + Intergenic
985116340 4:186595449-186595471 GAGAAGAACATATTCATTGAAGG - Intronic
986579186 5:9246226-9246248 GAAAAAAATCAAATCACTGGAGG + Intronic
986888446 5:12269950-12269972 GAGAAAAATGGAATTACAGAAGG + Intergenic
986931992 5:12836687-12836709 GAGAAAAATATATTTATTAATGG + Intergenic
988033820 5:25799268-25799290 GAGAAGAATATAAGAGCTGAGGG + Intergenic
988452803 5:31360126-31360148 GAGAAAAAGATAGTGATTGATGG + Intergenic
988575067 5:32414436-32414458 GAGAAATATATAATTATTTAAGG + Intronic
989489001 5:42028626-42028648 GAGAAAAACATGCTCACTAAAGG - Intergenic
989572716 5:42959822-42959844 GAGAAGAATATATCCACTGTGGG + Intergenic
990295647 5:54398918-54398940 AAAAAAAATAAAATCACTCAGGG + Intergenic
990297188 5:54414272-54414294 GATGAAAAAATAATAACTGAAGG + Intergenic
990617449 5:57521996-57522018 GAGAAAAATATGATAAGGGAGGG + Intergenic
992166066 5:74053127-74053149 GAGAAAAATATTAGAACTGCAGG + Intergenic
992345485 5:75872139-75872161 TGGAAAAATATCATCAATGATGG + Intergenic
992548408 5:77838238-77838260 GAGAAAAATATGTTCATTGTTGG + Intronic
993291262 5:86074401-86074423 GAGAGAAAGATAATGAATGAAGG + Intergenic
993906128 5:93625011-93625033 GAAAAAAATATCATAACTGATGG + Intronic
993994971 5:94711858-94711880 GGGAAGATTATAATCACTTAAGG + Intronic
994016476 5:94972427-94972449 GAGAATAAGATATTCTCTGAAGG - Intronic
994376161 5:99017124-99017146 GATAGAAATATAAACAGTGAAGG - Intergenic
995125861 5:108576542-108576564 GAGAAAAATATGATAAGGGAGGG + Intergenic
995169208 5:109087481-109087503 GACAAACATATAATCAGTGTTGG - Intronic
995382052 5:111546423-111546445 GAGAAAAATATTATAACATAAGG - Intergenic
995455717 5:112349694-112349716 GAGAAAAAGAAAGACACTGAAGG + Intronic
995697030 5:114890918-114890940 GACAAAAATAAAATCACAGATGG - Intergenic
996083166 5:119277392-119277414 GACAAAAAAAAAATCCCTGATGG - Intronic
996328841 5:122307784-122307806 GAGAAAAAAAGAAATACTGAAGG + Intergenic
996418061 5:123231139-123231161 AAGAATAATGTAATCATTGAAGG + Intergenic
996613954 5:125417070-125417092 GAGAAAAAAAAAATCACTCAAGG - Intergenic
997910628 5:137869408-137869430 GAGACAAATATAATCCTTCAAGG + Intronic
998026591 5:138821425-138821447 CAGAAAAAAATAATCACAAAAGG - Intronic
998986826 5:147767593-147767615 GAGAAAAATATAAACCTGGAGGG - Intronic
1000725561 5:164765873-164765895 GAGATAAATATAATAAGTGAAGG - Intergenic
1000983750 5:167844890-167844912 GAGAAAGATAGAAATACTGAAGG - Intronic
1002395928 5:178954367-178954389 GAGAAAAAGAAAAAAACTGAAGG - Intronic
1003494310 6:6650754-6650776 AAGAAAAATGTATTCAGTGATGG - Intronic
1003622797 6:7716468-7716490 GAAAAAAATATAATTACAGAAGG + Intergenic
1005078921 6:21937159-21937181 GACAATAATATAATCACTGGAGG - Intergenic
1005196948 6:23298237-23298259 GATAAATATTTAATCACGGAGGG + Intergenic
1005400910 6:25433356-25433378 GTGAAAAATATAATTACCCATGG + Intronic
1005480524 6:26250846-26250868 GATTAAAATAAAATCAATGAAGG - Intergenic
1005564753 6:27079775-27079797 AAGAATAAAACAATCACTGATGG + Intergenic
1005630723 6:27705321-27705343 GAGTAAAACCTAAACACTGAAGG - Intergenic
1005698884 6:28379631-28379653 TAGAAAAATATACTCTCTGAAGG + Exonic
1006808819 6:36806648-36806670 GAGATAAATTTTATCAGTGAGGG - Intronic
1006964200 6:37965626-37965648 GAGGAAACTATACTCCCTGAAGG + Intronic
1007508097 6:42352716-42352738 GAGATAAATATAATAACTGGGGG + Intronic
1007564302 6:42837297-42837319 CACAAAAATATAATTACCGAAGG + Intronic
1008023507 6:46607383-46607405 GAGTCAAATAGAATCACTAAAGG + Intronic
1009758260 6:67969281-67969303 GAGAAAAATACAGAAACTGAAGG + Intergenic
1010144535 6:72651772-72651794 GAGGAAAATAGAATAACTCAAGG + Intronic
1010697503 6:78994815-78994837 AAGAAGAGTATAATCACTGAAGG + Intronic
1011142299 6:84172112-84172134 GGGAAAAAAAAAATCACTGCTGG + Intronic
1011485715 6:87839481-87839503 GAGAAAAAAATAAACAATGGGGG - Intergenic
1011771829 6:90681986-90682008 GAGAAAAATGTAATCTGAGAGGG - Intergenic
1011950854 6:92961918-92961940 AAGGAAAATAAACTCACTGAAGG - Intergenic
1012669444 6:102023526-102023548 GAGAAAAATAAAACCATTTATGG - Intronic
1013022535 6:106233772-106233794 GAGAAAAATATGATAAGGGAGGG - Intronic
1013301304 6:108807522-108807544 GAGAAAAATTGAAAGACTGAAGG - Intergenic
1013411049 6:109883852-109883874 GAGAACAATATAAAAACTCATGG + Intergenic
1013426116 6:110014148-110014170 GAAAAATATAAAATCATTGATGG + Intergenic
1013454737 6:110320227-110320249 GAAAAAAATAAAAGCTCTGAAGG - Intronic
1013654869 6:112235910-112235932 GAGATAAATATAATGACCAAAGG + Intronic
1013671745 6:112411024-112411046 GATCAAAATATCATCAATGAGGG + Intergenic
1013855318 6:114565273-114565295 GAGAAAAATGTATTCTCTTATGG - Intergenic
1014810996 6:125885501-125885523 GAAAAGAATAAAATCAATGATGG + Intronic
1015077742 6:129181901-129181923 GAGAAAAATATTAAAACTGGGGG + Intronic
1015370815 6:132450135-132450157 GAAAGAAAGATAATCACTAAAGG - Exonic
1015781151 6:136867121-136867143 CAGAAAAATTTAAAAACTGATGG - Intronic
1016066378 6:139687591-139687613 GAGAAATTTCTATTCACTGAGGG + Intergenic
1016490631 6:144597428-144597450 TAGTAAAATATAATAAATGAGGG - Intronic
1016689224 6:146916667-146916689 GGGAACAATACATTCACTGAAGG - Intergenic
1017707566 6:157137954-157137976 GAGACACATATAATGAATGAAGG - Intronic
1018655377 6:166029274-166029296 GAAAAAAATGTAATCCCTGCAGG + Intergenic
1020490334 7:8774841-8774863 TAGAAAAATATCATCTCTGAAGG + Intergenic
1020752537 7:12160872-12160894 GATGAAAATATAATCAATAAAGG - Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021396329 7:20153076-20153098 GAGATAAATGTAGTCTCTGAGGG + Intronic
1022438726 7:30414325-30414347 GAGCAAAAGATACTCACTCAAGG - Intergenic
1023119081 7:36891203-36891225 TACTAAAATATAATCACTGTAGG + Intronic
1024723561 7:52166675-52166697 GAAGAAAATAAAATCATTGAAGG - Intergenic
1024751532 7:52471388-52471410 GAGAAAAAAATGATGAATGAAGG + Intergenic
1025084423 7:56011101-56011123 GAGAAACCAATATTCACTGAAGG + Exonic
1025274131 7:57559947-57559969 GAGACAAGTATAATTCCTGAAGG + Intergenic
1027675950 7:81158981-81159003 GAGAAAAATATATTAACTTGAGG - Intergenic
1028588018 7:92470355-92470377 GAGAAAAATATGATAAGGGAGGG + Exonic
1030212187 7:107007423-107007445 GAGAAAAATAGCAGCTCTGAAGG - Intergenic
1030488059 7:110196237-110196259 TAGAAAAATATAATCACATTAGG - Intergenic
1030951643 7:115797944-115797966 GAGAAAAATATATTCAAAAATGG + Intergenic
1030981583 7:116191204-116191226 AAGAAAAAGTCAATCACTGAAGG - Intergenic
1031014738 7:116560736-116560758 GAAAAAAAAATCATAACTGAAGG - Exonic
1031472624 7:122184772-122184794 GAGAAAATTATCTTCACTAAAGG + Intergenic
1031652450 7:124306989-124307011 TAGAAAAATATAAAAACAGAAGG + Intergenic
1032061148 7:128726423-128726445 GAGAGAAAAATCATCACTCAGGG - Intronic
1032608795 7:133388836-133388858 GATAAAAATAAAATGACAGATGG - Intronic
1032846538 7:135756327-135756349 GAAAAAACTGTAATCTCTGAGGG - Intergenic
1033786807 7:144741592-144741614 GTTAAAAATATAACAACTGAAGG - Intronic
1035052914 7:156013831-156013853 GAGATAAAAAAAATCACTGGAGG - Intergenic
1036099405 8:5761257-5761279 AAAAAAAATATAAATACTGAAGG - Intergenic
1036960769 8:13242387-13242409 GAGAAAAAAAAAAAAACTGATGG - Intronic
1037062088 8:14526537-14526559 GAAATAAATATAATCAAAGAAGG - Intronic
1037350088 8:17943745-17943767 GAGAAAAAAATAAACACAGGTGG - Intronic
1037491231 8:19398913-19398935 GCTGAAAATTTAATCACTGATGG - Intergenic
1037873485 8:22522692-22522714 GAGAAAATTGTAATAAGTGATGG - Exonic
1038137132 8:24798968-24798990 GAGAAAAATAAAAACACATAGGG + Intergenic
1038193037 8:25341372-25341394 ATGAAATATATAATCCCTGAAGG + Intronic
1039185815 8:34915057-34915079 GGTAAACATATGATCACTGAGGG + Intergenic
1040932912 8:52753860-52753882 TAGAAAAATTTAATCTTTGATGG + Intergenic
1041172058 8:55153537-55153559 GATAAAAATAAAATCAATGTGGG + Intronic
1043087987 8:75860564-75860586 TAGAAAAATGTATTCACTGTAGG - Intergenic
1043356416 8:79417728-79417750 CAGAAAGATATAAGCCCTGATGG - Intergenic
1044047553 8:87456255-87456277 GAGTGAAATATAATAACAGAAGG - Intronic
1044273180 8:90271020-90271042 GACTAAAACATAATCACTAAAGG - Intergenic
1044495391 8:92872592-92872614 AAGAAAAAAAAAATCACTGAAGG + Intergenic
1045116480 8:98988413-98988435 TAGGAAAACAAAATCACTGAAGG - Intergenic
1045795669 8:106040737-106040759 GAAAAAAAAAAAATCAGTGAAGG + Intergenic
1045981820 8:108198486-108198508 GAAGAAAATACAATTACTGAGGG + Intergenic
1046482013 8:114833918-114833940 GAGATAAATATTATGACAGATGG - Intergenic
1046910048 8:119616280-119616302 GAGAGAAATTTAATCATAGATGG - Exonic
1046941129 8:119932749-119932771 AAGAAAAATAGACTTACTGAGGG + Intronic
1047040139 8:120984463-120984485 AAGAAAAATGCAATCACTGGCGG - Intergenic
1047074772 8:121388800-121388822 TAGAAGAATAAAATCACTCATGG + Intergenic
1050620200 9:7444204-7444226 GAGAAAAATGTTTTCAATGAAGG + Intergenic
1050644859 9:7708344-7708366 GAGAAAAAAAAAATCCCTGTAGG + Intergenic
1050808751 9:9718319-9718341 AAGTAAAAAATAAACACTGACGG + Intronic
1050889669 9:10808488-10808510 AAAAAAAATATTATCAGTGATGG - Intergenic
1051393790 9:16596269-16596291 GGGAAAAATATATTTTCTGAAGG + Intronic
1051812001 9:21059864-21059886 GAAGAAAATATTATCACAGATGG + Intergenic
1051848374 9:21478838-21478860 GAGAAAAAAATAATTACAGAAGG + Intergenic
1052210465 9:25896869-25896891 GAGAAAAATAGAGAAACTGAAGG - Intergenic
1052238492 9:26243175-26243197 TACAATAATATAATCACTAATGG + Intergenic
1052405229 9:28051205-28051227 GAGAAAACTATACTAGCTGATGG - Intronic
1056239772 9:84632992-84633014 AGGAAAATTCTAATCACTGATGG - Intergenic
1056469136 9:86887700-86887722 GAGAAATATTTAATCTCTGAAGG - Intergenic
1056911927 9:90708814-90708836 AACAAAATTATAATCACTCAAGG + Intergenic
1057566510 9:96169850-96169872 GAGAAGAATAAAATCTCAGAAGG - Intergenic
1057640064 9:96810999-96811021 AATAAAAATATAAACACTCATGG + Intergenic
1058622283 9:106896199-106896221 GAGAAAAACAAAAACAATGAGGG - Intronic
1059804802 9:117787140-117787162 CAGAAAACTGTAATCACTCACGG + Intergenic
1060596033 9:124849480-124849502 GCAAAAAAGATAATCACTGGAGG + Intergenic
1061420205 9:130469386-130469408 GAGAAAGAAAAAATCACTAAGGG - Intronic
1203731355 Un_GL000216v2:94303-94325 GAGGAAAATATAATCATTTTGGG + Intergenic
1186613062 X:11157381-11157403 GAGAAACTTTTCATCACTGATGG - Intronic
1188027422 X:25224936-25224958 GTGAGAAATATAATAACTAAAGG - Intergenic
1188058040 X:25564295-25564317 AAAAAAAAAATAATCACTAAAGG + Intergenic
1188224208 X:27576593-27576615 CAGCAAAAAATAATCACTGTAGG + Intergenic
1188256433 X:27966823-27966845 AAGACAAGTGTAATCACTGATGG + Intergenic
1188333983 X:28905794-28905816 TAGAAAAATAAAAACACAGAAGG + Intronic
1188594887 X:31887706-31887728 AAGAAAAAAGTAATAACTGACGG - Intronic
1189414892 X:40804877-40804899 GAGAAAGATACAATGACTGAAGG - Intergenic
1189508904 X:41641486-41641508 GAGGAAAATATAATCTTAGATGG + Intronic
1189690217 X:43609769-43609791 GAGACAAATAAATTCACTAATGG - Intergenic
1190608197 X:52166829-52166851 AAGAAAAAGAAAATCATTGAGGG + Intergenic
1192809893 X:74538202-74538224 AATAAAATTATCATCACTGAGGG + Intergenic
1193290280 X:79764842-79764864 GAGAAAAATATCTTCACTAGAGG - Intergenic
1194071885 X:89334931-89334953 TAGAGAAATAAAATCATTGAGGG - Intergenic
1194106028 X:89768129-89768151 CAGAAAAATAGAAACACAGATGG - Intergenic
1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG + Intergenic
1194567730 X:95513914-95513936 GTGAAAAATATATTCAATCATGG + Intergenic
1195387486 X:104326658-104326680 GGGAAAAATATAGTCAGTTAGGG - Intergenic
1195550539 X:106164516-106164538 AAGAAAAATACACTCACTGTTGG + Intergenic
1195630894 X:107054108-107054130 GAGAAAAATATGATAAGGGAGGG + Intergenic
1195792757 X:108607033-108607055 AAGACAAAAATAATCAATGAAGG - Intronic
1196639515 X:118041764-118041786 GAGAAAATTATTTTCACTAAAGG + Intronic
1197658801 X:129147839-129147861 GAGAACAATGTAATCAGTGAAGG + Intergenic
1198013997 X:132589991-132590013 CACAAAAATATCAACACTGAAGG + Intergenic
1198028426 X:132731485-132731507 GAGAAATATATTATCATAGACGG + Intronic
1198472740 X:136964102-136964124 CAGGAAGAAATAATCACTGAAGG - Intergenic
1199299479 X:146196219-146196241 GAAAAAAATATAATAACAGAAGG - Intergenic
1199411702 X:147531221-147531243 AAGAAAAATAAAATGCCTGAGGG + Intergenic
1199732096 X:150644749-150644771 GAGAATAATATAATCTCATAGGG - Intronic
1199898513 X:152149920-152149942 GGGAAATATATACTCACTGGGGG - Intergenic
1200457984 Y:3415988-3416010 CAGAAAAATAGAAACACAGATGG - Intergenic
1200726131 Y:6670659-6670681 TAGAGAAATAAAATCATTGAGGG - Intergenic
1201335487 Y:12876363-12876385 GATCAGAATATAATTACTGAGGG - Intergenic
1201728115 Y:17176525-17176547 TAAAAAAATATATTCAGTGAAGG + Intergenic
1202111242 Y:21422535-21422557 GAGAAAAATATAATATCAAAGGG + Intergenic