ID: 981126868

View in Genome Browser
Species Human (GRCh38)
Location 4:141117173-141117195
Sequence TACCATATCCATAGGTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981126865_981126868 23 Left 981126865 4:141117127-141117149 CCAGAACTTAAAGTATAATAAAA 0: 1130
1: 3126
2: 3594
3: 2921
4: 3360
Right 981126868 4:141117173-141117195 TACCATATCCATAGGTGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 125
981126864_981126868 24 Left 981126864 4:141117126-141117148 CCCAGAACTTAAAGTATAATAAA 0: 4172
1: 11838
2: 19568
3: 8336
4: 4491
Right 981126868 4:141117173-141117195 TACCATATCCATAGGTGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981126868 Original CRISPR TACCATATCCATAGGTGGCA AGG Intronic
900471790 1:2858564-2858586 ACACATATCCATAGTTGGCAGGG - Intergenic
902552826 1:17229416-17229438 TCCCATGTCCATAGCAGGCAAGG - Intronic
905737991 1:40343971-40343993 TAGCATATCCATAGGTTCCAGGG + Intergenic
906196792 1:43934736-43934758 TGCCAGATCCATAGGAGGCTGGG + Intronic
911061517 1:93751873-93751895 TACCAGAGCCAAAGCTGGCATGG - Intronic
911308793 1:96266815-96266837 TACAATATCCATATGGAGCAGGG - Intergenic
911997136 1:104780503-104780525 TAGCATAACCATAGGTGCCAGGG + Intergenic
912376088 1:109210963-109210985 TCACATATTCAAAGGTGGCAGGG + Intergenic
916402916 1:164468442-164468464 TATCATTTCCATTGGTGGTAGGG - Intergenic
918405083 1:184204262-184204284 TACCATACCCACAGGTCCCAGGG - Intergenic
918744100 1:188177209-188177231 TTACATATCCATAAGAGGCATGG - Intergenic
922874165 1:228927056-228927078 TACCATGTCCACAGGGGTCAGGG - Intergenic
923072023 1:230574460-230574482 AAAAATATCCATAGGTGGGAAGG + Intergenic
1062901682 10:1151311-1151333 TCCCACATCCATCTGTGGCATGG + Intergenic
1066133554 10:32418689-32418711 TCCCATAGCAATAGGTGGAAGGG + Intergenic
1071583362 10:86794130-86794152 TAACATATTCATAGGTTACAGGG + Intronic
1080709671 11:34734704-34734726 TACCATATTCACAGGTTCCAGGG - Intergenic
1080789237 11:35506570-35506592 TGCCATATTCTTGGGTGGCAGGG + Intronic
1081406509 11:42704953-42704975 TAACATATTCATAGGTTCCAAGG - Intergenic
1082771222 11:57209206-57209228 TACCACATCCCTAGGAGGTAGGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085198192 11:74684665-74684687 TCCCATATCCCTAGGAGGAAGGG - Intergenic
1086121078 11:83304959-83304981 TAACATATTCATAGGTCCCAGGG - Intergenic
1089758843 11:120708120-120708142 TACCATCTCCATATGAGCCATGG + Intronic
1097086485 12:56472168-56472190 TTCCATATCCATGGCTGACAAGG + Exonic
1098998929 12:77154149-77154171 TAACATATTCATAAGTTGCAGGG - Intergenic
1101316110 12:103630482-103630504 TAACATATTCATAGGTTCCAGGG - Intronic
1106198802 13:27518745-27518767 TACCATGTTCATGGGTGGGACGG + Intergenic
1111434544 13:88189556-88189578 TGACATTTCCATAAGTGGCATGG + Intergenic
1112569681 13:100582426-100582448 TAACATATTCATAGGTTCCAGGG - Intronic
1119206155 14:72795087-72795109 TAACATATTCATAGGTTCCAAGG + Intronic
1122306562 14:100770393-100770415 TAGCATATCCAAAGGTACCAAGG - Intergenic
1126091085 15:45052503-45052525 TCCCATTTCACTAGGTGGCATGG + Intronic
1126216165 15:46157355-46157377 CACTATATCCCTTGGTGGCAAGG - Intergenic
1126258339 15:46654734-46654756 TACCATATTCACAGGTTCCAGGG + Intergenic
1128880979 15:71242673-71242695 TACCATAGCCATACTTGCCAGGG - Exonic
1129570598 15:76680156-76680178 TTCCACAGCCATAGGTGACAAGG + Intronic
1130067580 15:80617412-80617434 TAACATATCCACAGGTTCCAGGG + Intergenic
1133003733 16:2865649-2865671 TACCAGATCCACAGTTTGCAGGG + Intergenic
1137882292 16:52062601-52062623 TAACATATTCATGGGTTGCAGGG + Intronic
1138162656 16:54770027-54770049 TACCATATTCATGGATGGAATGG + Intergenic
1138824180 16:60298794-60298816 TAACATATTCATAGGTGTAATGG + Intergenic
1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG + Intronic
1141041145 16:80673730-80673752 TACCACATTCATAGGTCCCAGGG - Intronic
1146536910 17:33660722-33660744 TACCACATCAGTAGGTGACAAGG + Intronic
1150335431 17:64327167-64327189 TACATTCTCCATATGTGGCAGGG + Intronic
1150640948 17:66949019-66949041 TAACATATCCACAGGTTCCAGGG + Intergenic
1151345415 17:73498419-73498441 AAACATTTCCAAAGGTGGCAGGG + Intronic
1156314233 18:35952262-35952284 TAACGTATTCATAGGTGCCAGGG + Intergenic
1158820249 18:61150875-61150897 TACCACATCCATCTGTGTCAAGG - Intergenic
1159230057 18:65594919-65594941 TTCCATATCAATAGGTGAGAAGG - Intergenic
1159901271 18:74048948-74048970 TACCATTTTCATAGATGGAAAGG - Intergenic
1161914330 19:7217412-7217434 TACCAAATTCACAGGTGACAGGG + Intronic
1162048611 19:8018275-8018297 TACCATATTCATGGGTTCCAGGG - Intronic
1166598997 19:44077213-44077235 TAAAATATCCATATGTGGCATGG + Intronic
1166620136 19:44290169-44290191 TGGCATATCCACAGGTGGCCTGG - Intronic
1166679985 19:44760038-44760060 TACCATATCCCTTGGGTGCATGG + Exonic
926547129 2:14255597-14255619 TACCAACTCAATAGGGGGCAAGG + Intergenic
928305826 2:30169685-30169707 GACCTTCTCCATATGTGGCAAGG - Intergenic
928383607 2:30844888-30844910 TATCATATCTATTGCTGGCAGGG + Intergenic
938842338 2:135175166-135175188 TACCATGTCCCTCGGTGGCAGGG - Intronic
941943092 2:171064452-171064474 TAGCAAATACATAGGTGGCCTGG - Intronic
944862580 2:203829046-203829068 TAACATATTCAGAGGTTGCAGGG + Intergenic
945105876 2:206313766-206313788 TACCATTTTCATTGGGGGCAGGG + Exonic
946325499 2:218982727-218982749 GACCACATCCAGAGGTGGGAAGG + Intronic
946994794 2:225379210-225379232 AAGCATGTCCATAGGAGGCAAGG + Intergenic
948989423 2:241545153-241545175 TCCCATATTCACAGGTGCCAGGG + Intergenic
1169445196 20:5665806-5665828 CACCATATCCATAGATGTCCTGG - Intergenic
1169546018 20:6651796-6651818 CATCATATCCTTATGTGGCAGGG + Intergenic
1169915794 20:10681819-10681841 TTTGATATCCATAGATGGCAGGG - Intergenic
1175102428 20:56588924-56588946 TAATATATCCATAGGTTGCAGGG + Intergenic
1175730083 20:61348451-61348473 GACCATATCAATAGGAGACAAGG + Intronic
1177630793 21:23724976-23724998 TACCATCACATTAGGTGGCAGGG + Intergenic
1177771056 21:25516280-25516302 TAACATATTCACAGGTTGCAGGG + Intergenic
1178804074 21:35823951-35823973 TAACATATCCATAGGTTTTAAGG - Intronic
1181539377 22:23565378-23565400 TACCATCTCCATAGGAGGCCTGG + Intergenic
1182844361 22:33418366-33418388 TAACATATCCACAGGTTCCAGGG + Intronic
1184688532 22:46107225-46107247 TCCCAGATCCATTGTTGGCACGG + Intronic
953542897 3:43838035-43838057 TAACATATCCATAGGTTTCAGGG + Intergenic
955463188 3:59208159-59208181 TAACATATTCATAGGTTCCAGGG - Intergenic
956353036 3:68359321-68359343 TAACATATTCATAGGTGCTAGGG - Intronic
956453355 3:69395765-69395787 TAACATAGCCATAGGTTTCAAGG - Intronic
958708047 3:97681218-97681240 TATAATATCCAGAGCTGGCAGGG + Intronic
959827966 3:110822885-110822907 AACCATTTCCATAGGTGTAATGG - Intergenic
962032939 3:131620543-131620565 TAACATATCCACAGGTCCCAGGG - Intronic
962078732 3:132114609-132114631 TAGCATATCCATAGCTGTGATGG - Intronic
966482037 3:180421195-180421217 TAACATATTCATAGGTTCCAGGG - Intergenic
967849668 3:194072158-194072180 TACCATGTCCAATGGTGGGAGGG - Intergenic
967992287 3:195140344-195140366 TACCAGCTCCGGAGGTGGCACGG + Intronic
976925034 4:90485592-90485614 TACCATATACCTATGTGTCATGG + Intronic
980518731 4:133902103-133902125 TTCCACTTCCATAGGTGTCATGG + Intergenic
981126868 4:141117173-141117195 TACCATATCCATAGGTGGCAAGG + Intronic
981294919 4:143120792-143120814 TATCATATGCAGTGGTGGCAGGG - Intergenic
982527890 4:156502768-156502790 TAGCATATACATAGGTGCCAGGG + Intergenic
983052573 4:163065939-163065961 TAACAAGTCCATAGATGGCAGGG + Intergenic
983846460 4:172525918-172525940 TTCATTATTCATAGGTGGCATGG - Intronic
987249616 5:16085528-16085550 GATGATATCCATAGTTGGCATGG + Intronic
987742718 5:21930418-21930440 TACAATATCCATATTTGCCAGGG + Intronic
988305061 5:29483550-29483572 TACCAAATCTCTAGGAGGCAGGG + Intergenic
990653828 5:57932816-57932838 TACAATATCCATTTGTCGCATGG - Intergenic
991335339 5:65540718-65540740 TACCATGTCCAGAGATGGCATGG + Intronic
991461013 5:66858774-66858796 TACCATATACATAGAAGGAAAGG - Intronic
991577428 5:68119777-68119799 TACCATTTTCATAGGTTGCTAGG - Intergenic
992206295 5:74433590-74433612 TACCATATCCACAGCGGGGAGGG - Intergenic
995520610 5:113000873-113000895 TACTGTATCCACAGGTGGTATGG - Intronic
1000015904 5:157275768-157275790 TCCCATGTCCATAGGTTGGAAGG - Intronic
1000684010 5:164224512-164224534 TACCATTTCTAGAGGTGGCCAGG - Intergenic
1002333624 5:178463003-178463025 TACCTTACCCAAAGGTTGCAAGG + Intronic
1004759235 6:18647850-18647872 TAACATATCCACAGGTTCCAGGG - Intergenic
1006532027 6:34663816-34663838 TAACATATTCATAGGTTCCAGGG - Intronic
1009227613 6:61033156-61033178 TGTAATATCCATAGGTGGGAGGG - Intergenic
1015272573 6:131352549-131352571 TAATATATCCATAGGTCCCAAGG - Intergenic
1018209700 6:161469074-161469096 TACCATATTCATAAGTTCCAGGG - Intronic
1020652557 7:10893209-10893231 AACCATATCAGTAGGTGACAGGG - Intergenic
1022276717 7:28862518-28862540 TACCATTTACAGAGATGGCAAGG + Intergenic
1026742101 7:72985150-72985172 AAGCATATCCATATGTGGCTGGG + Intergenic
1029574306 7:101392903-101392925 TAGCATATTCACAGGTTGCAGGG - Intronic
1030254468 7:107492818-107492840 TAACATATTCATAGGTTCCAAGG + Intronic
1030772410 7:113490645-113490667 TAACATTTCCATAGGAGGCTTGG + Intergenic
1031399083 7:121309903-121309925 TAACATATTCATAGGTTCCAGGG - Intergenic
1034231035 7:149528748-149528770 TTCCATTTCACTAGGTGGCATGG - Intergenic
1042859310 8:73296456-73296478 TACCATTTTCATTGGTGGTATGG + Intronic
1048685212 8:136897369-136897391 TACCATCACCTTAGGGGGCAGGG - Intergenic
1052713797 9:32090203-32090225 TACGATATCAATAGGTGGTAGGG - Intergenic
1056198321 9:84250127-84250149 TAACATATTCATGGCTGGCAGGG - Intergenic
1059415166 9:114157658-114157680 TAACATATCCACTGGTGGTAGGG + Intronic
1059965101 9:119606003-119606025 AACCATATGCAGAGATGGCAGGG - Intergenic
1062251734 9:135600919-135600941 TACCATATCCATGGATTGGAAGG + Intergenic
1188717726 X:33480970-33480992 TTCCATACTCATAGGTGGGAGGG + Intergenic
1190381330 X:49842044-49842066 TAACATATTCATAGGTCCCAGGG + Intergenic
1194187321 X:90789541-90789563 TACAATATCCAGTGCTGGCAAGG + Intergenic
1194920346 X:99758060-99758082 TGCCATAGCCCTTGGTGGCAAGG - Intergenic
1196253258 X:113486353-113486375 CACCATAGCCCTTGGTGGCAAGG + Intergenic
1200533915 Y:4371498-4371520 TACAATATCCAGTGCTGGCAAGG + Intergenic
1201683012 Y:16669914-16669936 TCACATATCCATAGGTTCCAGGG - Intergenic
1202045087 Y:20729760-20729782 TACCAAATGCAAAGATGGCAAGG + Intergenic