ID: 981127570

View in Genome Browser
Species Human (GRCh38)
Location 4:141124044-141124066
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 2, 1: 15, 2: 17, 3: 59, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981127570_981127577 10 Left 981127570 4:141124044-141124066 CCCTTCAGCTCCTGCTTTAAGGT 0: 2
1: 15
2: 17
3: 59
4: 229
Right 981127577 4:141124077-141124099 CCCGAAGGAAAAATCCACTGTGG 0: 1
1: 4
2: 7
3: 15
4: 113
981127570_981127573 -5 Left 981127570 4:141124044-141124066 CCCTTCAGCTCCTGCTTTAAGGT 0: 2
1: 15
2: 17
3: 59
4: 229
Right 981127573 4:141124062-141124084 AAGGTCCATGAATACCCCGAAGG 0: 1
1: 1
2: 26
3: 32
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981127570 Original CRISPR ACCTTAAAGCAGGAGCTGAA GGG (reversed) Intronic
901890429 1:12258836-12258858 ACCACACAGCAGGTGCTGAAGGG - Intronic
904365270 1:30007031-30007053 ACCTTAAATTGGGAGCTTAAGGG + Intergenic
904414181 1:30345951-30345973 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
906041493 1:42791004-42791026 ACCTGAGAGCAGGTGCTGGATGG + Intronic
906651098 1:47513437-47513459 ACCTAAAAACAAGAGCCGAATGG + Intergenic
908208195 1:61872701-61872723 ACCTTAAAGCAGGAGCGTAAGGG - Intronic
910006450 1:82403115-82403137 AGCTTAAAGCAGTTGCTGTAAGG + Intergenic
910674088 1:89799945-89799967 ACCTGAAAGGAGGAGGTGAGGGG + Intronic
911068994 1:93817248-93817270 GCATCAAAGCAGGGGCTGAAGGG + Intronic
911457039 1:98138495-98138517 ACTTATAAGCAGGAGCTAAACGG - Intergenic
912058620 1:105636258-105636280 AACTTAAAGCAGTAGAAGAAAGG - Intergenic
912462685 1:109847105-109847127 ACCTTCAGGCAGGAGCTTGAGGG - Intergenic
914347935 1:146815718-146815740 ACCCTAAAGCTGGAGCCTAAGGG - Intergenic
916124343 1:161555989-161556011 AGCTGAAGGCAGGAGCTGAGGGG + Intergenic
917360164 1:174166115-174166137 TCCTTAGAGTAGAAGCTGAAGGG + Intronic
918940160 1:190984039-190984061 ACATTAAACCAGAATCTGAATGG + Intergenic
919872311 1:201831507-201831529 ACCTTAAAACAGGTACAGAAGGG - Intronic
921927693 1:220725972-220725994 ACCTAAAAGAAGGAGAAGAAAGG - Intergenic
923887627 1:238176822-238176844 ACATTAAAGTAGGAGCTAAAGGG - Intergenic
1063112632 10:3049929-3049951 ACCTTAGAGCAGGAGCAGCAAGG + Intergenic
1064109332 10:12524288-12524310 ACCTTAAAGTAGGCTGTGAATGG - Intronic
1066436282 10:35399091-35399113 ACTTGAAAGCATGAGCTGATTGG + Intronic
1069249801 10:66254449-66254471 ACTTTAAAGTGGGAGCTTAAGGG - Intronic
1069759881 10:70801466-70801488 ACCTTAAGGCGGGAGCTTAAGGG + Intergenic
1071061486 10:81575153-81575175 ACCTTCAAGCAGGTACTGACAGG + Intergenic
1072015396 10:91341826-91341848 ATCTTGAAGCAGGAGCTTACAGG - Intergenic
1072267128 10:93741636-93741658 ACCTTAAGGCGGGAGCTTAAGGG - Intergenic
1072282553 10:93880862-93880884 ACTTTAAGGCAGGAGCTTGAGGG + Intergenic
1072426081 10:95332031-95332053 ACCTTAAGGCAGAAGCTTAAGGG - Intronic
1072471091 10:95713800-95713822 ACCATGAAGCAGCAGCAGAAAGG + Intronic
1075157587 10:119990799-119990821 ACCTTCAGACAAGAGCTGAAAGG - Intergenic
1076184250 10:128434181-128434203 ACCTGAAATCAGGACCTCAAAGG + Intergenic
1076499098 10:130921721-130921743 ACCTTGATGCAGGTGCTGAAGGG - Intergenic
1079347110 11:19662663-19662685 ATCTTAAGGAAGCAGCTGAATGG - Intronic
1079870122 11:25787155-25787177 ACCCTAAACCAGAAGCTAAAGGG - Intergenic
1079999446 11:27331043-27331065 ACCTTAAAGCACAAGCTGTGAGG - Intronic
1081722572 11:45301158-45301180 ACCTTAAAAAAGGAGATGCAAGG - Intergenic
1083869561 11:65478479-65478501 ACCTTAAAGAGGGAGCTTAAGGG + Intergenic
1084024852 11:66441487-66441509 ACCTTAAAGAGGGAGCTTGAGGG - Intronic
1086252529 11:84833750-84833772 ACCTTAATGCATGAGCTAACAGG - Intronic
1087238590 11:95750032-95750054 AAATCAAAGCAGAAGCTGAAAGG - Intergenic
1089000174 11:115045199-115045221 ATCATAAAGCAGGACCTTAAAGG - Intergenic
1090260585 11:125315932-125315954 ACCTTGTAGCAGGAGCTGTGAGG + Intronic
1093074141 12:14739776-14739798 ACCTTGAAGAGGGAGCTTAAGGG - Intergenic
1093546917 12:20359568-20359590 AACTTAAAGCAGGGCGTGAATGG - Intergenic
1094700355 12:32864115-32864137 CCATTAAAGCAGGAGTAGAAGGG + Intronic
1094737807 12:33254874-33254896 ACCTTAAGGCGGGAGCCGAGGGG + Intergenic
1095045319 12:37497121-37497143 ACCATAAATCAACAGCTGAATGG + Intergenic
1095578647 12:43769302-43769324 ACCTAAAAGCATAAGGTGAAAGG + Intronic
1096314308 12:50550794-50550816 ACCTTAAATCTGTAGCTGAATGG - Intronic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1098197966 12:68022312-68022334 GCCTGAAAGCAGAAGCTGAAAGG - Intergenic
1098937097 12:76492486-76492508 ACCACACAGCAGGAGGTGAAAGG + Intronic
1099166893 12:79317843-79317865 ACCTTAAGGCGGGAGCTTAAGGG + Intronic
1099343419 12:81467917-81467939 AACTTAGAGCAGGAGCCCAAAGG - Intronic
1100237686 12:92677413-92677435 AACTTAAAGCTGGGGGTGAAGGG + Intergenic
1100427340 12:94499505-94499527 ACCTTAAGGTAAGAGCTTAAAGG - Intergenic
1100891466 12:99130909-99130931 TCCTTAAAGGATGAGTTGAAGGG - Intronic
1101418507 12:104529634-104529656 ACCTTGGACCAGGAGATGAAAGG - Intronic
1103094223 12:118119862-118119884 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1104231163 12:126885725-126885747 ACCTTAGAGCAGGAGCTTAAGGG - Intergenic
1105335329 13:19462255-19462277 ACCTTAAAGCAGTCCTTGAAAGG + Intronic
1106639011 13:31563364-31563386 ACCACACAGCAGGAGGTGAATGG + Intergenic
1106883792 13:34160433-34160455 ACCTTGAAGGAGGAGCTGACAGG - Intergenic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108354278 13:49616234-49616256 GCCTCAAAACAGGAGCTGATGGG - Intergenic
1108434354 13:50387154-50387176 AGCTTAGAGCAGAAGCTGAAAGG + Intronic
1109157932 13:58934808-58934830 ACCTTAAGGCAGGAGCTTAAGGG + Intergenic
1111128289 13:83940970-83940992 AACTTAAAGCAGAAGCTGAAGGG - Intergenic
1112245525 13:97729988-97730010 AACTGAAAGCAGGAGGGGAAAGG - Intergenic
1112487278 13:99831319-99831341 ACCATTAATCAGGAGCTGCAAGG + Intronic
1112565656 13:100549478-100549500 ACATGAAATCAGGAGCTAAAAGG + Intronic
1112751358 13:102587051-102587073 ACCCAAAAGCAGAAGCTGATTGG + Intergenic
1114132897 14:19813534-19813556 ACCTTAAAGTGGGAGCTTAAGGG + Intronic
1114347224 14:21808739-21808761 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
1114439736 14:22736632-22736654 ACCTTAATGCAGGAGCTGAAGGG - Intergenic
1115384246 14:32777150-32777172 ACTTAAAAGCAAGACCTGAAAGG + Intronic
1116030876 14:39569845-39569867 ACCTAAAATCATGACCTGAAAGG + Intergenic
1119454472 14:74742896-74742918 ACCACACAGCAGGAGATGAATGG - Intergenic
1119631672 14:76237488-76237510 GCCTGAAGGCAGGAGCAGAAAGG - Intronic
1120095909 14:80387442-80387464 CCCATAAAGAAGGAGCTGAAAGG + Intronic
1122702618 14:103600125-103600147 ACCTTAAGGTGGGAGCTTAAGGG + Intronic
1122939998 14:104976996-104977018 ACCGTGAAGCAGGTGCTGTAGGG + Intronic
1123575984 15:21669358-21669380 ACCTTAAAGTGGGAGCTTAAGGG + Intergenic
1123612605 15:22111832-22111854 ACCTTAAAGTGGGAGCTTAAGGG + Intergenic
1124416284 15:29475434-29475456 ACCTCAGAGCAGGATCTGGAAGG + Intronic
1127236655 15:57060113-57060135 ACCTTAAAGAAGGAATAGAAAGG - Intronic
1127774296 15:62253428-62253450 AGCTCAAAGCAGGGGCTGCACGG + Intergenic
1128645522 15:69376032-69376054 AGCTTGAGGCAGGAACTGAAAGG + Intronic
1130329518 15:82910432-82910454 ACCTTAAGGCAGGAGCTTGAGGG + Intronic
1131007836 15:88992993-88993015 GACCTAAAGCAGGAGCTGAAGGG + Intergenic
1131191806 15:90323007-90323029 GACCTAAAGCAGGAGATGAAGGG - Intergenic
1131202687 15:90413469-90413491 AACTTAAAGCAGGAGCTTAAGGG + Intronic
1202984852 15_KI270727v1_random:403603-403625 ACCTTAAAGTGGGAGCTTAAGGG + Intergenic
1133229773 16:4360970-4360992 ACCTTCAGGCTGGAGCTGATCGG - Exonic
1135965500 16:27031713-27031735 ACCATTGAGCAGGAGGTGAATGG - Intergenic
1136221621 16:28833110-28833132 ATCTTAAAGGAGGAGCCCAAAGG + Exonic
1137945364 16:52728904-52728926 ACCACAAAGCAGGAGGTGAGTGG - Intergenic
1138023408 16:53503850-53503872 AGCTGAAGGCTGGAGCTGAAGGG + Intronic
1138321858 16:56121028-56121050 AACTTAGAGCAGGAGCGGAGAGG + Intergenic
1138836383 16:60441144-60441166 ACCTTTGAGCAGAAGATGAAAGG + Intergenic
1138851477 16:60634564-60634586 ACCTTAAAGCAGGCGCTTTAGGG + Intergenic
1139050400 16:63118126-63118148 ATCTTAAAGCAACATCTGAAAGG + Intergenic
1139986100 16:70899814-70899836 ACCCTAAAGCTGGAGCCTAAGGG + Intronic
1140053014 16:71499496-71499518 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1140815785 16:78619517-78619539 GCATCACAGCAGGAGCTGAAAGG - Intronic
1140991349 16:80215088-80215110 TCCTTCAAGAAGGAGCTCAAAGG + Intergenic
1141952945 16:87350769-87350791 CACTTAAAGCGGGAGCTGAGGGG - Intronic
1142321945 16:89388874-89388896 TCCTAAAAGCAACAGCTGAAAGG + Intronic
1144401944 17:14913174-14913196 TCCTGCAAGCAGGAGGTGAAGGG + Intergenic
1146137865 17:30338900-30338922 ACCTTAAAGCAATACCTGAAGGG + Intergenic
1146612515 17:34320283-34320305 ACGTTAAAGCAGCAGGTGATTGG - Exonic
1149768299 17:59298805-59298827 ACCTTAAGGCAGAAGCTTGAGGG - Intergenic
1149818083 17:59746732-59746754 ACCAGAAAGGAGGAGATGAAGGG + Intronic
1151506053 17:74527853-74527875 ACCTTACAGCAGGAGGTGAGCGG + Intronic
1154458917 18:14559433-14559455 ACCTTAAAGTGGGAGCTTAAGGG + Intergenic
1155559652 18:27062009-27062031 GACTTAACGCAGGAGCTGAAGGG - Intronic
1156291692 18:35753532-35753554 ACCTTAAAGTGGGAGCTTAAGGG - Intergenic
1157911182 18:51618676-51618698 ACCTTAAAGTGGGAGCTAAATGG - Intergenic
1158138237 18:54228909-54228931 ACCTTAAAGCAGGAGCTTAAAGG - Intergenic
1158689100 18:59644275-59644297 ACCGCACAGCAGGAGCTGAGTGG - Intronic
1158862949 18:61610864-61610886 ACCTTCCAACAGGATCTGAAAGG + Intergenic
1160616912 18:80137332-80137354 ACCTGACGGCAGGAGCTGGATGG - Exonic
1161796672 19:6391000-6391022 ACCTTAAATCAAGAGCTTAAGGG - Intronic
1161925388 19:7295192-7295214 ACCTTACTGCAGGAGAGGAAGGG + Intergenic
1162439217 19:10682405-10682427 TCCTGGGAGCAGGAGCTGAAAGG + Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1164412875 19:28020456-28020478 GGTTTAAAGCAGCAGCTGAAAGG - Intergenic
1165961989 19:39542561-39542583 ACCTTACAGCAGAAGCTGAAAGG + Intergenic
1166269064 19:41702459-41702481 ACCTCACAGCAGGAGCAGAGTGG + Intronic
1166341003 19:42136867-42136889 ACCTTCAGCCAGGAGCTGATGGG - Intronic
1166610218 19:44185227-44185249 AACTCAAAGCAGGATCTCAAAGG - Intergenic
927321279 2:21748627-21748649 ACCTTAAAGCGGGAGCTTAGGGG + Intergenic
927572970 2:24175681-24175703 GCTTTAAAGCAGGCGTTGAAGGG + Exonic
928999989 2:37337996-37338018 ACCTTAAAGCGGGAGTTTAATGG + Intergenic
930049829 2:47206373-47206395 AACTTGAAGCAGGAAGTGAATGG - Intergenic
930117206 2:47728422-47728444 ACCTTAAAGCGAGAGTTTAAGGG + Intronic
930573284 2:53113366-53113388 ACCTTAAAGGGGGAGCTTAACGG + Intergenic
930996533 2:57726122-57726144 ACATGAAAGCAGTAGCTGGAAGG - Intergenic
931341968 2:61410463-61410485 GCCACACAGCAGGAGCTGAAGGG - Intronic
932020097 2:68075710-68075732 ACCTTAAAGCGGGAGCATAAGGG - Intronic
932924596 2:75958186-75958208 CCCATAAAGCAGAAGGTGAAAGG - Intergenic
933798428 2:85940530-85940552 TTCTTAAAGGAGGACCTGAATGG - Intergenic
934017502 2:87904333-87904355 ACCTGAAGGCAGAAACTGAAAGG - Intergenic
934950408 2:98571754-98571776 TCATTAAAGCAGGGGCTGCAGGG + Intronic
936773039 2:115938049-115938071 ACCTTAATGCAGGAACTTCAGGG + Intergenic
937838820 2:126503878-126503900 ACCTTAAAGTTGGAGCTTAAGGG - Intergenic
938758311 2:134400805-134400827 GCCTTAAAGCAGGAGATGGGCGG - Intronic
939076601 2:137609903-137609925 ACTTTGAAGATGGAGCTGAAAGG + Intronic
941993161 2:171576525-171576547 ACCTTAAGGCAGGAGCTGAAGGG + Intergenic
942694055 2:178618747-178618769 ACCCCAAAGCAGAAGCTGAATGG - Exonic
942792031 2:179771507-179771529 ATTTTAAGGCAGGAGCTAAAAGG - Intronic
944906042 2:204263217-204263239 TCTTGAAAGCACGAGCTGAAAGG + Intergenic
945366156 2:208956849-208956871 ACCTGACAGCAGGATCTTAAAGG - Intergenic
945478070 2:210309553-210309575 ACCTCAAAGCAGAATTTGAAGGG - Intronic
945557683 2:211299721-211299743 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
946116861 2:217470567-217470589 ACTTTAACCCAGGAGGTGAAGGG - Intronic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
947515018 2:230795668-230795690 AACTAAAACCAGGAGGTGAAAGG - Intronic
1169999449 20:11598146-11598168 ACCTTAAAGCAGGAAGTGAAAGG - Intergenic
1171539873 20:25940726-25940748 ACCATAAATCAACAGCTGAATGG + Intergenic
1171842788 20:30235944-30235966 ACCATAAATCAACAGCTGAATGG + Intergenic
1173988363 20:47280289-47280311 CCCTTAAAGCAGGTGCTGAGAGG + Intronic
1175056327 20:56201938-56201960 ACCTTAAAGCGGGAACTTCAGGG - Intergenic
1175057473 20:56211333-56211355 ACCTTAAAGCAGGAGCCTAAAGG - Intergenic
1176815225 21:13593892-13593914 ACCTTAAAGTGGGAGCTTAAGGG - Intergenic
1178261489 21:31104188-31104210 ACCTTACAGTGGGAGCTTAAGGG - Intergenic
1178977795 21:37234456-37234478 AGCTTAAAGCAGGCTTTGAACGG + Intronic
1181766293 22:25094520-25094542 AACTTGAAGAAGGAGCAGAATGG + Intronic
1181833554 22:25582907-25582929 ACCACAAAGGAGGAGATGAATGG + Intronic
1183066542 22:35367511-35367533 ACCTTAAAGCGGGAACTTAAGGG - Intergenic
1184855783 22:47145930-47145952 TCCTTAAAGCAGGGGTTGACTGG + Intronic
1184855814 22:47146073-47146095 TCCTTAAAGCAGGGGTTGACTGG + Intronic
1185149181 22:49154361-49154383 GCCCTAAAGCAGGTTCTGAAAGG - Intergenic
949308797 3:2672855-2672877 GCCTTAAACCAGTAGCTGGATGG - Intronic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
950620005 3:14197434-14197456 ACCTTGAAGCATGAGCTTAGTGG - Intronic
950748120 3:15107101-15107123 ACCTTAAAGCGGGAGCTTAAGGG + Intergenic
950930315 3:16782749-16782771 AGCTAAAAGTAGGAGATGAAAGG + Intergenic
951535447 3:23736272-23736294 AGCTTGAAGCAGGAGCTGGCAGG - Intergenic
951777660 3:26326788-26326810 ACCTAAGAGCAAGAGCTGGAAGG - Intergenic
953597694 3:44333929-44333951 AGCTTAAAGCAGGAGCTTAAGGG + Intergenic
956601482 3:71027382-71027404 ACCAGAAAGCAGGAGATGAAGGG + Intronic
956701948 3:71966462-71966484 AGCTGAAAGCAGGGGCTGACAGG + Intergenic
956734000 3:72222650-72222672 ACCACAAAGCAGGAGGTGAGTGG - Intergenic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
960009651 3:112819631-112819653 ACATTAAAGAAGGGGCTGGAGGG + Intronic
960766443 3:121135719-121135741 ACCACACAGCAGGAGGTGAATGG - Intronic
962481536 3:135802401-135802423 ACCTTAAGGCATGAGCTTAAGGG + Intergenic
963456033 3:145549355-145549377 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
963489135 3:145976823-145976845 ACCTTACAGCAGGAGGGAAAAGG + Intergenic
964308271 3:155363501-155363523 ACCTTAAAGCGGAAGCTGAAGGG - Intergenic
964687647 3:159414932-159414954 ACCTAACAGCAGGAGGTGAGTGG - Intronic
964885071 3:161472655-161472677 ACCTTAAAATAGGAGCTTAAGGG + Intergenic
966286507 3:178302328-178302350 ACCTTATAGCAGGATTTGATAGG - Intergenic
966347602 3:178996791-178996813 GCCTTAAAGCAGGAGACTAAGGG + Intergenic
967153545 3:186671837-186671859 ACCTGGCAGCAGGAACTGAATGG + Intronic
967216125 3:187212069-187212091 ACTTTAAAGGTGGAGCTGAGAGG + Intergenic
970460200 4:16267200-16267222 ACCTTAAAGCAAGAGAAAAAGGG + Intergenic
971588594 4:28437191-28437213 ACCTTAAGCCAGGAGCTTAAGGG - Intergenic
972444078 4:39127000-39127022 ACCTTAAAGCAGGAGTGTAAGGG - Intergenic
974277987 4:59751451-59751473 ACCTTAAAGCGGGAGCTTAAAGG - Intergenic
974574328 4:63698508-63698530 ACCTTAAAATGGGAGCTTAAGGG - Intergenic
976318935 4:83689366-83689388 ACCATAAAGGAGTAGCAGAAAGG - Intergenic
976385627 4:84454361-84454383 ACTTGGAAGCAGGAGTTGAAAGG + Intergenic
976707281 4:88032613-88032635 ACCTTAAATGAGGACCAGAAAGG - Intronic
977785309 4:101026544-101026566 GGCTTAAAGCAGGAGCTAAAAGG + Intronic
978213626 4:106170026-106170048 GCCATACAGCAGGAGGTGAATGG - Intronic
978900918 4:113948720-113948742 ATATTAGTGCAGGAGCTGAAAGG + Intronic
979283919 4:118899297-118899319 ACTTTAAAGCATGAGATAAAAGG + Intronic
979591166 4:122482102-122482124 ACATTAAAGTGGGAGCTTAAGGG + Intergenic
980983766 4:139675753-139675775 ACCTTAAAGCAAGAGCTTAGGGG + Intronic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
981526477 4:145711154-145711176 ACCTTAAAGCAGAAGCTTTAAGG - Intronic
983233823 4:165156379-165156401 ACCTTAAGGCCAGAGCTCAAGGG - Intronic
984038576 4:174700518-174700540 ACCTTTAAGTAGTCGCTGAAAGG + Intronic
985955826 5:3265487-3265509 ACCTGTAAGCAGGACCTGAGTGG - Intergenic
986809568 5:11341374-11341396 GCATTCAAGCAGGGGCTGAATGG + Intronic
987573847 5:19702022-19702044 TCCTTAAAGCAGGAGCTTAAGGG - Intronic
987599903 5:20054251-20054273 TGCTTAAAACATGAGCTGAATGG + Intronic
987835782 5:23159588-23159610 ACCTTCAAGCAGGAGCTGAAGGG + Intergenic
989628791 5:43460230-43460252 GCCGCAAAGCAGGAGGTGAACGG - Intronic
990914543 5:60889941-60889963 ACCTTAACGCAGCAACTAAAAGG - Intronic
991474828 5:67008164-67008186 CCCTCAAAGCAGCAGGTGAATGG - Intronic
992652742 5:78876791-78876813 ACCTCACAGCAGGAGGTGAGCGG + Intronic
993772764 5:91951128-91951150 ACCTTGAATCTGGAACTGAAAGG + Intergenic
994835305 5:104844205-104844227 ATCTTAAAGCAGGGGCTTACGGG - Intergenic
996557690 5:124796122-124796144 GCCTCACAGCAGGAGGTGAAGGG + Intergenic
996753681 5:126914547-126914569 AACTTGAAGCAGGAGATAAATGG - Intronic
997612610 5:135225772-135225794 ACCTTACAGCCAGAGATGAATGG - Intronic
999482742 5:151964076-151964098 ATCTGGAAGCAGGAGCAGAATGG - Intergenic
1000889771 5:166788527-166788549 ACCTTAAAGGAAGAGTTGTAAGG - Intergenic
1001072603 5:168599926-168599948 ACCTTAAAGTGGGAGCTTAAGGG + Intergenic
1001100888 5:168813485-168813507 TCCTTTCAGCAGAAGCTGAAGGG + Intronic
1001629456 5:173163946-173163968 ATCCTGAAACAGGAGCTGAAAGG - Exonic
1002798403 6:496041-496063 ACCCTAAAACAGGAACTAAATGG - Intronic
1002986859 6:2198184-2198206 AACTTGCAGCAGGAGCTAAAGGG + Intronic
1003484264 6:6562376-6562398 ACATTAAGGCAGAAGGTGAAGGG + Intergenic
1004642773 6:17531762-17531784 TCCTAAAAGGAGAAGCTGAAGGG - Intronic
1005264978 6:24102168-24102190 ACCTTAACGTGGGAGCTGAAGGG + Intergenic
1005921439 6:30405458-30405480 ACCGCACAGCAGGAGGTGAAGGG + Intergenic
1007141240 6:39576674-39576696 ACCTAAGAGCAGGAGCTGACAGG - Intronic
1007365412 6:41388407-41388429 ATCTTAAGGCTGGGGCTGAATGG - Intergenic
1009684351 6:66936908-66936930 TGCTGAAAGCAGGAGCTGAAAGG + Intergenic
1011591790 6:88977022-88977044 AACTTAAGGCGGGAGCTTAAGGG - Intergenic
1012523300 6:100146475-100146497 ACCTGGAGGCAGGAGCTGTAGGG + Intergenic
1013538673 6:111087248-111087270 GCCTCAAAGCATGAGCAGAAGGG - Intergenic
1014549494 6:122773294-122773316 TCCTTAAAGGAGGAACTTAAGGG - Intergenic
1015555357 6:134455484-134455506 ATCTTAAAGGAGGAGTTAAAGGG + Intergenic
1015753916 6:136589006-136589028 ATCTCATAGAAGGAGCTGAAAGG - Intronic
1016028606 6:139314445-139314467 AACTTGAAGCAGGAGCTTATAGG - Intergenic
1016597491 6:145817636-145817658 TCCTTATAGCAGAAGTTGAAGGG + Intergenic
1016945280 6:149526391-149526413 ACCCTAAAACAGGAAATGAATGG - Intronic
1018043500 6:159945707-159945729 ACCTAATAGCAGAAGATGAAAGG - Intergenic
1019648747 7:2144874-2144896 ACCTTGGAGCAGGAGCTTCATGG - Intronic
1020762795 7:12289316-12289338 ACCTTAAAGTGGGATCTTAAGGG + Intergenic
1021100847 7:16585087-16585109 ACCTTAAAGGAGGAGGCCAAAGG - Intergenic
1022316039 7:29246538-29246560 ACCTGCAAGCAGGTGCTCAATGG - Intronic
1022918371 7:34984888-34984910 ACCTTAAAGCAGGAGAATACTGG - Intronic
1023216455 7:37868262-37868284 ACCTTAAAGCTGGAGCTTAAGGG + Intronic
1023529559 7:41138070-41138092 AGCAGAAAGCAGGAGCTTAATGG - Intergenic
1024536472 7:50438934-50438956 AACTTGAAGCAGCAGCTGTAAGG + Intergenic
1024790097 7:52956309-52956331 TCCTTGAAGCAGGAGCTTACAGG - Intergenic
1025291251 7:57726648-57726670 ACCATAAATCAACAGCTGAATGG + Intergenic
1026399390 7:69993922-69993944 AACTTACAGCAAGAGCTGTATGG + Intronic
1029155471 7:98514420-98514442 ACCCAAAAGCAGGGACTGAAGGG - Intergenic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1031523295 7:122793091-122793113 ACAGTAAAGGAGGACCTGAATGG - Intronic
1031875152 7:127131076-127131098 ACCTTAGTGCAGGAGTTGCATGG + Intronic
1033269737 7:139920091-139920113 ATCCCACAGCAGGAGCTGAATGG - Intronic
1034902950 7:154919004-154919026 ACCTTCAAGCAGGAGCTGAAGGG - Intergenic
1035889751 8:3330522-3330544 ACTTCTAAGCAGGAGCTAAATGG + Intronic
1036488611 8:9202623-9202645 ATCTTGAAGCAGGAGCTCACAGG - Intergenic
1038572548 8:28675415-28675437 ATCTTAAAGAGGGAGCTTAACGG - Intronic
1039354585 8:36801003-36801025 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1039364173 8:36913261-36913283 CCCTTAAAGAAGGAGCTGACTGG + Intronic
1040922026 8:52631680-52631702 ACCTTAAGGCAGGATCTTAAAGG - Intronic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1042721720 8:71833565-71833587 AACTTTAAGCAGGTGCTGAGGGG - Intronic
1044569709 8:93703359-93703381 ACCTTAAAGTAGTAGTTTAAGGG - Intronic
1044858314 8:96497439-96497461 TCCTAAAAGCAGAAGCTGAAGGG - Intronic
1046012914 8:108572117-108572139 ACTAAAAAGCAGTAGCTGAATGG + Intergenic
1047978861 8:130159160-130159182 ACCCTAGAGCAGGGGCTGAGGGG + Intronic
1050115669 9:2260868-2260890 AGTTTCAAGCAGGAGCTGACTGG + Intergenic
1050352742 9:4755804-4755826 ATCTTGAAGCAGGAGCTTACAGG + Intergenic
1050589925 9:7150212-7150234 GCCTTAAAGAAAGAGGTGAAAGG - Intergenic
1050612178 9:7364310-7364332 TCCTTGCAGCTGGAGCTGAAGGG + Intergenic
1050990559 9:12146048-12146070 ACCTTAAGACAAGAGCTTAAGGG - Intergenic
1051349180 9:16183038-16183060 TCTTTAAAGCAGAAGCTGCAGGG - Intergenic
1052298039 9:26920781-26920803 AGCTGATAGCAGTAGCTGAAGGG - Intronic
1054165194 9:61718723-61718745 ACCATAAATCAACAGCTGAATGG - Intergenic
1055293650 9:74811966-74811988 ACCTTAAAGTGGGAGCTTAAGGG + Intronic
1056514982 9:87341706-87341728 ACTGGGAAGCAGGAGCTGAAGGG - Intergenic
1056927058 9:90844091-90844113 ACCATCGAGCGGGAGCTGAATGG + Exonic
1057181299 9:93032175-93032197 AACTGAAAGGAGGATCTGAAGGG - Intronic
1057831891 9:98413606-98413628 AACTGAAAGAAGGAGCAGAATGG + Intronic
1059235747 9:112759416-112759438 ACCTTAAAACAGGAAGTGGAGGG - Intronic
1061064465 9:128268718-128268740 AGCTCAAAGCAGGGGCTGCACGG + Intronic
1061440072 9:130595978-130596000 ACCTTAAAGAAAGAGAAGAATGG + Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1203532133 Un_GL000213v1:155530-155552 ACCTTAAAGTGGGAGCTTAAGGG + Intergenic
1185946666 X:4384562-4384584 ACCTTAAAGGGGGAGCTGAAGGG + Intergenic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186168874 X:6856483-6856505 AACTTAAAGCGGGAACTGAGAGG - Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1186538046 X:10370095-10370117 ACCATCAAGCAGGGTCTGAATGG - Intergenic
1188954007 X:36413212-36413234 AAATTAAAGTAGGAGATGAAGGG - Intergenic
1189692880 X:43635324-43635346 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1189693462 X:43639857-43639879 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1191069572 X:56385683-56385705 ACCTTACAGTGGGAGCTGAATGG + Intergenic
1192479563 X:71473291-71473313 ACCTTTAAGCTGAATCTGAATGG + Intronic
1193478593 X:81997855-81997877 ACTTAAAAACAGGAGCTAAATGG + Intergenic
1193500447 X:82267455-82267477 AACTTAAAGCAGGAGCTTAAGGG + Intergenic
1194931963 X:99900003-99900025 ACCTTTAAGCAGGACCTGGAGGG - Intergenic
1195112446 X:101661015-101661037 ACCTGAATGCAGGAGATGAGCGG - Intergenic
1196847181 X:119905562-119905584 ACCATAAATCAGGAGGGGAAAGG - Intronic
1197829340 X:130625378-130625400 ACCTTCAAGCAGGAAATGACTGG - Exonic
1198825138 X:140691350-140691372 ACCTTAAAGCAGGGGCCCACAGG + Intergenic
1198844336 X:140894131-140894153 ACCTTAATGTGGGAGCTGAAGGG - Intergenic
1199126981 X:144134212-144134234 ACCTGAAGGCAGAAACTGAAAGG + Intergenic
1199427372 X:147718455-147718477 ACCTTCAAGCTGTGGCTGAACGG - Intergenic