ID: 981128607

View in Genome Browser
Species Human (GRCh38)
Location 4:141133374-141133396
Sequence GCCTGGGCACGCACTTGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981128598_981128607 28 Left 981128598 4:141133323-141133345 CCGGTTCCCTCAGGCTGCGGGCG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 118
981128599_981128607 22 Left 981128599 4:141133329-141133351 CCCTCAGGCTGCGGGCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 128
Right 981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 118
981128603_981128607 -2 Left 981128603 4:141133353-141133375 CCTGATCTCGCCGGTGGCTGCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 118
981128600_981128607 21 Left 981128600 4:141133330-141133352 CCTCAGGCTGCGGGCGCTGCGCT 0: 1
1: 0
2: 3
3: 17
4: 160
Right 981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981128607 Original CRISPR GCCTGGGCACGCACTTGCCG CGG Intronic
900172164 1:1274360-1274382 GGCTGGGCAGGCACCTGCAGGGG - Intergenic
905249323 1:36637943-36637965 CCCTGGGCTGGCTCTTGCCGTGG - Intergenic
905950442 1:41946309-41946331 GCATGGGCTGGCACTTGCCCCGG - Intronic
907037437 1:51228927-51228949 GCATGGGCTGGCACTTGCCCTGG - Intergenic
907505544 1:54915441-54915463 GCATGGGCTGGCACTTGCCCCGG + Intergenic
910591088 1:88928663-88928685 GCATGGGCTGGCACTTGCCCCGG - Intergenic
912463865 1:109855859-109855881 GTATGGGCAGGCACTTGCCCCGG + Intergenic
913470410 1:119180538-119180560 GCATGGGCTGGCACTTGCCCTGG + Intergenic
913532022 1:119740377-119740399 GCCTGGGCATTCACCTGCAGAGG - Exonic
915310522 1:155003932-155003954 GCCTGGGCAGGCACGTGTCCGGG - Intronic
919369130 1:196702821-196702843 GCTTGGGCACTCCCTTGCAGAGG - Intronic
920700795 1:208216950-208216972 GCCTGGGGACTCACTGGCCCAGG - Exonic
1063172195 10:3518862-3518884 GGCTGGGCATTCACTTGCCTGGG - Intergenic
1064990726 10:21254683-21254705 GCCTGGCCACGTCCTTGCAGTGG - Intergenic
1069495584 10:68900912-68900934 GCGTGGGCAGGCCCATGCCGAGG - Intergenic
1070954398 10:80454684-80454706 GCACGGGCGCGCACTCGCCGGGG - Intronic
1074705558 10:116126688-116126710 GCCTGAGGAGGAACTTGCCGGGG - Intronic
1076837201 10:133027140-133027162 GCCTGGGGACCAGCTTGCCGTGG + Intergenic
1076868188 10:133179661-133179683 GCCTGGCCACGCACGTGAAGTGG - Intronic
1078654126 11:13222403-13222425 GCCTGGGTAGGCAGTTGCCAGGG - Intergenic
1081166109 11:39810629-39810651 GCCTGGGGACCCACTTGAGGAGG - Intergenic
1083748158 11:64746290-64746312 GCCGTGGGACGCACCTGCCGAGG + Intergenic
1083959549 11:66007050-66007072 GCCTGGCCACCCACTAGCCTGGG + Intergenic
1086106895 11:83156836-83156858 GCCTGGGAAGGCAGTTCCCGCGG - Intergenic
1087792318 11:102419524-102419546 GACTGGACACGCAGTTGCCCTGG - Intronic
1089696299 11:120218309-120218331 GCCAGGCCACGCACATCCCGAGG - Intronic
1091787589 12:3252395-3252417 GCCTGTGCACACACCTGCCACGG - Intronic
1092062703 12:5564228-5564250 GCTTTGGCACACACTTGCAGTGG + Intronic
1095139026 12:38639983-38640005 GCATGGGCTGGCACTTGCCCTGG - Intergenic
1097377209 12:58855513-58855535 GCATGGGCTGGCACTTGCCCTGG + Intergenic
1099605314 12:84795975-84795997 GCATGGGCTGGCACTTGCCCCGG - Intergenic
1102419626 12:112793507-112793529 GCCTGAGCAGGCACATGCTGTGG - Intronic
1102969488 12:117155251-117155273 CCCTGGGCTGGCACCTGCCGGGG + Intronic
1104924208 12:132305699-132305721 GCCTGGGCACAGCCTTGCCTGGG + Intronic
1113752444 13:112785573-112785595 GCCTGGCCACGTGCTTGTCGTGG + Intronic
1117198136 14:53361754-53361776 GCATGGGCTGGCACTTGCCCCGG - Intergenic
1127074238 15:55310358-55310380 GCATGGGCTGGCACTTGCCCCGG + Intronic
1127265186 15:57355273-57355295 GACTGGGCACCCACTTGCCATGG - Intergenic
1129702024 15:77773692-77773714 GCCTGGGGTCACACTTGCCTGGG + Intronic
1131072785 15:89476654-89476676 GCCTGGGGACCCAGATGCCGGGG - Intronic
1131157628 15:90084802-90084824 CCCAGGCCACGCACTTGCTGAGG + Exonic
1133208234 16:4246975-4246997 TTCTGGGCACGCACTTCCTGTGG + Intergenic
1133387294 16:5379992-5380014 GCCTGGGCACAGCCTTGCAGTGG + Intergenic
1136061541 16:27730036-27730058 GCCTGGGCATGAGCTTGCAGGGG - Intronic
1136683900 16:31983184-31983206 GCCTGGGCCTGCTCTGGCCGTGG + Intergenic
1136784529 16:32926736-32926758 GCCTGGGCCTGCTCTGGCCGTGG + Intergenic
1136885254 16:33927070-33927092 GCCTGGGCCTGCTCTGGCCGTGG - Intergenic
1203087188 16_KI270728v1_random:1190742-1190764 GCCTGGGCCTGCTCTGGCCGTGG + Intergenic
1144453169 17:15398058-15398080 GAATGGGCAAGCACTTGCCATGG + Intergenic
1148126038 17:45237479-45237501 GCCTGTGCCCACCCTTGCCGCGG + Intronic
1148547914 17:48531016-48531038 GCCTGGGCAAGCGCTTCCCTAGG + Intergenic
1148791946 17:50178204-50178226 GCCTGGGCACACACGTCCAGAGG + Intergenic
1149548770 17:57524131-57524153 GCCTGGGCATGCCCTTGTCATGG + Intronic
1151806021 17:76405960-76405982 GCTAGGGCAGGCACTTGCAGAGG - Intronic
1151979237 17:77499021-77499043 GCCAGGCCTCGCACTTGCAGAGG + Exonic
1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG + Intronic
1152152229 17:78609363-78609385 GCCCCTGCACGCACTTGCCTGGG + Intergenic
1158932288 18:62333787-62333809 GACTGGGCACGCATTTGCATGGG - Intronic
1160908805 19:1465431-1465453 GGCTGGGCACGCAGCTGCCTGGG - Exonic
1161168135 19:2799601-2799623 GCCTGGGAACCCTCTCGCCGAGG - Intronic
1162457975 19:10797231-10797253 GCCTGCGCCCGCATTTGCCCCGG - Intronic
1168268923 19:55239259-55239281 TCCTGGGCACGCGTTGGCCGTGG - Intronic
928476503 2:31632513-31632535 GCATGGGCTGGCACTTGCCCCGG - Intergenic
934672012 2:96220158-96220180 GCATGGGCTGGCACTTGCCCCGG + Intergenic
934685940 2:96321796-96321818 GCCTGTGCACGCGCCTGCGGAGG - Intergenic
935748738 2:106212121-106212143 GCATGGGCTGGCACTTGCCCTGG - Intergenic
938236141 2:129708669-129708691 GCCTGAGCACCCTCTTGGCGCGG - Intergenic
946359901 2:219213007-219213029 GCCTGGACAGACACTTGCCCTGG - Exonic
948477190 2:238227683-238227705 GAATGGGCCCGCACTTGCCCAGG - Exonic
948616617 2:239203226-239203248 GGGTGGGCACCCACTTGCTGGGG - Intronic
1169141332 20:3228880-3228902 GCCAGGGCTCGCACGTGCAGCGG + Exonic
1172101251 20:32484705-32484727 ACCCGGGCACGCACTGTCCGTGG + Intronic
1174977164 20:55348986-55349008 GCATGGGCTGGCACTTGCCCCGG - Intergenic
1176866161 21:14056260-14056282 CCCTGGGCATGCCCTTGCCCTGG - Intergenic
1181997218 22:26892466-26892488 TTCTGGGCACGCACTGGCCTGGG + Intergenic
1183489524 22:38109115-38109137 GCCCGGGCAGGCACTCACCGTGG + Exonic
954110189 3:48429267-48429289 GCCTCGGCGCGCACATCCCGCGG - Exonic
955581648 3:60429543-60429565 GCCTGGGGAGGCTCTTGCCAGGG - Intronic
956129368 3:66039290-66039312 GCCTGGCCAGCCACTGGCCGAGG - Intergenic
962495500 3:135935671-135935693 GCATGGGCTGGCACTTGCCCTGG - Intergenic
963290070 3:143478363-143478385 GGCAGGGCACACACTTGCCCTGG + Intronic
967993134 3:195146526-195146548 CACTGGGCAGGCATTTGCCGAGG - Intronic
968530881 4:1090980-1091002 GCCTGTGCAAGCACTGGCCATGG - Intronic
968568801 4:1328731-1328753 GCAAGGGCAGGGACTTGCCGCGG - Intronic
968597125 4:1491343-1491365 GGCTGGGCACGCACTGGCCCTGG - Intergenic
968891633 4:3372398-3372420 ACCTGGGCACTCACTTGCAGTGG - Intronic
969475910 4:7422380-7422402 GCCTGGGCAGGCCCCTCCCGTGG + Intronic
969586552 4:8097397-8097419 GCCTCGGCACACACTTGGGGTGG + Intronic
969858591 4:10018957-10018979 GCCTTGGCGCGCACTCACCGGGG + Exonic
971191005 4:24429097-24429119 GCCTGAGCAGGCACTGGGCGAGG + Intergenic
974520524 4:62975782-62975804 GCATGGGCTGGCACTTGCCCTGG - Intergenic
976189899 4:82477791-82477813 GCATGGGCTGGCACTTGCCCTGG - Intergenic
977617955 4:99106310-99106332 GCATGGGCTGGCACTTGCCCTGG + Intergenic
981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG + Intronic
988883002 5:35524514-35524536 GCCTGGGCAAGCACATGGTGAGG - Intergenic
998170671 5:139870478-139870500 TCCTGGGCACACCCTTGCCCGGG - Intronic
998175699 5:139900735-139900757 GCCTGGGCAGGCCCTAGCCCTGG - Intronic
998571179 5:143259374-143259396 ACCTGGGCAGGTACTTACCGTGG - Intergenic
1002068104 5:176662591-176662613 GCCTGAGCAGGGACCTGCCGGGG - Intergenic
1003645577 6:7910785-7910807 GGCTGGGCGCGCTCTCGCCGCGG + Exonic
1011076830 6:83447167-83447189 GCATGGGCTGGCACTTGCCCTGG - Intergenic
1017511295 6:155116748-155116770 GCCTGGGTAAGCACTTCCCAAGG - Intronic
1017740194 6:157399676-157399698 GCCTGGGAGAGCCCTTGCCGGGG - Intronic
1017827908 6:158095974-158095996 CTCTGGGCACCCACCTGCCGCGG + Exonic
1021840991 7:24721783-24721805 GCCTGGGAACGCACTGGACATGG - Intronic
1024045433 7:45582551-45582573 GCCAGGGCAGGCACCTGGCGGGG + Intronic
1029264274 7:99326056-99326078 GCCTGGCGCCGGACTTGCCGCGG + Intronic
1029692145 7:102189619-102189641 GCCTGGGCACGCACTCACACTGG + Intronic
1033306916 7:140231578-140231600 GCCTGGGCACACACCTGTCCTGG - Intergenic
1034968431 7:155405120-155405142 GCCTGGGCAGGCACCAGACGGGG - Intergenic
1035930912 8:3778534-3778556 GCCTGTGCACGCTCTTGCCTGGG + Intronic
1036207418 8:6815415-6815437 GCTAGGGCACCCACTTCCCGGGG + Intronic
1036708506 8:11062184-11062206 GCCTGGGCACGGACTAGCCCAGG - Intronic
1045510725 8:102810479-102810501 GGCTTGGCGCGCACTCGCCGAGG + Intergenic
1048854351 8:138673783-138673805 CCCTGGGCATGCACCTGCCCAGG + Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060996596 9:127877646-127877668 GGCAGGGCACGCACTGGCCCCGG - Exonic
1062562647 9:137148531-137148553 GCCTGGCCACCCACTCGCCGGGG + Intronic
1189482773 X:41405925-41405947 GCTTGGGCACATACTTGCAGGGG - Intergenic
1189946594 X:46186871-46186893 GCATGGGCTGGCACTTGCCCCGG - Intergenic
1192174669 X:68878293-68878315 GACTGGGCACCCACTTCCCCTGG - Intergenic
1192939916 X:75901494-75901516 GCATGGGCTGGCACTTGCCCCGG + Intergenic
1193171920 X:78346955-78346977 GCATGGGCTGGCACTTGCCCTGG + Intergenic
1197715981 X:129706405-129706427 GCCTGGGCACCCACCTTCAGTGG - Intergenic
1201724049 Y:17134659-17134681 GCATGGGCTGGCACTTGCCCAGG + Intergenic