ID: 981129283

View in Genome Browser
Species Human (GRCh38)
Location 4:141140480-141140502
Sequence AAAAGGAAACAGATGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 8, 3: 68, 4: 626}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981129283 Original CRISPR AAAAGGAAACAGATGTATTG TGG (reversed) Intronic
901111669 1:6801962-6801984 ACTAGGAAACAGATGGTTTGGGG + Intronic
901530799 1:9851334-9851356 AAAAAGAAAAAGAAGGATTGTGG - Intronic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
902853905 1:19185548-19185570 AAAAGAAATCAGTTTTATTGGGG - Intronic
903546377 1:24126153-24126175 AAAAGGAAACTGACGTTCTGGGG - Intronic
903794850 1:25920973-25920995 AGAAGAAAACAGCTTTATTGAGG - Intergenic
904213300 1:28899785-28899807 AAAAGGAAGGGGATGGATTGAGG + Intronic
904214161 1:28906274-28906296 ATAAGGAAGCAGGGGTATTGGGG - Intronic
904230219 1:29063619-29063641 TGTAGGAAACAGCTGTATTGGGG - Intronic
905857699 1:41325203-41325225 AATATGAAACAGATCAATTGAGG + Intergenic
905977755 1:42191188-42191210 GCAAGGAAACAGATGTAAAGAGG + Intronic
906231358 1:44167453-44167475 AAAATGAAAAAGAAATATTGAGG - Intergenic
906540556 1:46582549-46582571 AAAACAAAACAGATGAAGTGGGG + Intronic
906623393 1:47304463-47304485 AATAGAAAATAGATCTATTGAGG - Intronic
906704946 1:47888042-47888064 AATAATAAACAGATGTATTATGG - Intronic
906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG + Intronic
907269423 1:53282139-53282161 AAAAGGGCACAGATGAGTTGGGG + Intronic
908468754 1:64421464-64421486 TGAATGAAACAGATGTATTTTGG - Intergenic
909553912 1:76931350-76931372 AAAAGAACACATATGTATTGTGG - Intronic
909810694 1:79929151-79929173 AGAAGCAAACAGGTGTGTTGTGG - Intergenic
909855730 1:80528897-80528919 AAAAGGAAACAACTTTATTTTGG - Intergenic
910659866 1:89660305-89660327 CAGAAGAAACAGATGTTTTGGGG + Intronic
910790007 1:91041425-91041447 AAAAGCAAACAGGGGTATTGGGG - Intergenic
910950264 1:92639360-92639382 AAAAGTAAATATTTGTATTGGGG + Intronic
910950270 1:92639444-92639466 AAAAGTAAATATTTGTATTGGGG + Intronic
911191152 1:94949768-94949790 TAAAGGAAACACATTTATTTGGG - Intergenic
911289067 1:96033644-96033666 AAAAGTAAATAGATGCATGGAGG - Intergenic
911641485 1:100294762-100294784 AAAAAAAAAAAGATGTATTAAGG - Intergenic
911980152 1:104557250-104557272 AGAAGGAAACAGGGGTGTTGGGG - Intergenic
912305101 1:108559627-108559649 AAAAGGAAAATGATGTGCTGAGG - Intergenic
912944143 1:114070591-114070613 AGAAGGAAACAGGGGTGTTGGGG + Intergenic
914383370 1:147141536-147141558 AAAAGGAAACACTTGTATACTGG - Intergenic
914785361 1:150824429-150824451 AAAAGAAAACAGATGTTCTCAGG - Intronic
915062373 1:153196917-153196939 AAAAGGAAACAGAAGCCTGGTGG + Intergenic
915917485 1:159949775-159949797 AAAAGGAATCAAAGGGATTGGGG + Intergenic
916142760 1:161713415-161713437 ATAAAGAATCAGATTTATTGGGG - Exonic
916381236 1:164214117-164214139 AAAAGGAAAGACATGGAGTGGGG + Intergenic
916472122 1:165134306-165134328 AGAAGGAAGCAGATGTGTTTTGG - Intergenic
916988290 1:170214999-170215021 AGAGGGAAACAGATTTATTTTGG + Intergenic
917114709 1:171591211-171591233 AAAAGGAAGCACTTATATTGTGG - Intronic
917206211 1:172573031-172573053 AAAAAAAAACAGCTTTATTGGGG + Intronic
917451723 1:175152743-175152765 AATAGGAAACAACAGTATTGCGG + Intergenic
918480976 1:184976074-184976096 AAAAGGAAACAGAAATTTTGAGG - Intergenic
918698544 1:187577480-187577502 AAGAGCAAACAGAACTATTGAGG - Intergenic
918927269 1:190804345-190804367 AGAAGGAAAATGATGTATTTAGG + Intergenic
919197610 1:194308952-194308974 AAAAGAAAAAAAATCTATTGGGG + Intergenic
919241488 1:194922083-194922105 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
919524642 1:198632809-198632831 AAAAGAAAACATAGGCATTGAGG - Intergenic
920197101 1:204235947-204235969 AGAAGCAAACAGAGGTGTTGGGG - Intronic
920353573 1:205353768-205353790 AAAAGGAAACAAACATTTTGAGG + Intronic
921329043 1:214017166-214017188 AAAAAAAAAAAGATGTTTTGTGG + Intronic
921494093 1:215815161-215815183 AAGAGGCAACACAGGTATTGCGG - Intronic
921568173 1:216745888-216745910 AAAAGTATACAAATGTAATGTGG + Intronic
921640066 1:217542664-217542686 AAAAGGAAATAGATGTTTATTGG - Intronic
921799908 1:219390769-219390791 AAAAGGTAACAAATTTATTAAGG - Intergenic
922633404 1:227138304-227138326 AAAAGGAGACAGTAGTACTGGGG + Intronic
922856234 1:228777017-228777039 AAAAGGAAAAGAATGTTTTGTGG + Intergenic
923677160 1:236089921-236089943 AAAAGGGAATAATTGTATTGTGG + Intergenic
924096471 1:240556578-240556600 AAAAGAAAAGAGAAATATTGAGG + Intronic
924676491 1:246183726-246183748 AAAAGGAAACAGGTAAAATGAGG + Intronic
1063020859 10:2126311-2126333 AAAAGGGAAAAGATGTAAAGCGG - Intergenic
1064293864 10:14059951-14059973 AAAAGGAAACCGAGGCATAGTGG + Intronic
1064494665 10:15896642-15896664 AGAAGAAAACAGCTTTATTGAGG + Intergenic
1065208476 10:23379676-23379698 AAAAGTATACAGATTTAATGTGG - Intergenic
1065468437 10:26050764-26050786 AAAAGGAATCAGATGTCTGGAGG - Intronic
1065519836 10:26561015-26561037 AAAAGAAAACAGATGTTATAGGG - Intronic
1065568003 10:27035617-27035639 AAAAGAAAAGAAATGTTTTGAGG - Exonic
1065575577 10:27114689-27114711 ATAAGGAAACAAATATATGGGGG + Intronic
1066053674 10:31660701-31660723 AATAGGAACCAGAGTTATTGTGG - Intergenic
1066071705 10:31822193-31822215 CAAAGAAAACAGAATTATTGTGG + Intronic
1066312044 10:34206540-34206562 AGAAGGAAACAGCTTTATTGAGG + Intronic
1066354969 10:34674437-34674459 AGAAGAAAACAGCTGTATTGAGG - Intronic
1066711858 10:38245047-38245069 TAAAGGAAAGAGAGGTATTATGG + Intergenic
1067514157 10:46922558-46922580 AAAAGGAAAGAGATAACTTGAGG + Intronic
1067648096 10:48129274-48129296 AAAAGGAAAGAGATAACTTGAGG - Intergenic
1068212790 10:53943110-53943132 AATAGCAAACAGATGAATTATGG - Intronic
1068598879 10:58934763-58934785 AAAAGGGAACACATGAATTAAGG + Intergenic
1069183775 10:65396638-65396660 AACAGGAAACAGATAAATGGGGG - Intergenic
1069791098 10:71021506-71021528 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1070340931 10:75497990-75498012 AAAAGGAAACAGCCGCTTTGGGG - Intronic
1070427715 10:76305379-76305401 AAAAGAAAAAAGATGTTTTGAGG - Intronic
1071347971 10:84711472-84711494 CAAGGGAAACAGATGTATTAAGG - Intergenic
1071378072 10:85030999-85031021 AAAAGCAAACAGGGGTGTTGGGG - Intergenic
1071470316 10:85979569-85979591 AAAAGGAGACATTTGTATTCAGG - Intronic
1072616500 10:97052629-97052651 AAAAAGAAACAGCTCTATTGAGG - Intronic
1072826833 10:98615225-98615247 AAAAAGAAACAGAGGTCTAGAGG + Intronic
1072841197 10:98775850-98775872 AAAAAGAAACAGATTTATTGGGG - Intronic
1073229368 10:101954964-101954986 AAAAGGAAAGAGTTGGAGTGGGG - Intronic
1073998538 10:109343446-109343468 AAATGCAAACAGCTGTGTTGTGG + Intergenic
1074120615 10:110491554-110491576 AAAAGGAAACAAGTGTATCCTGG - Intergenic
1074264127 10:111884041-111884063 AAAAGGGAACAGAGATATTTGGG - Intergenic
1074720775 10:116263304-116263326 AAAAGGACTGAGATTTATTGAGG + Intronic
1075606552 10:123815697-123815719 AGAAGGAAACAGGGGTGTTGGGG - Intronic
1075765589 10:124890493-124890515 CACATGAAACACATGTATTGAGG - Intergenic
1076099783 10:127766816-127766838 AACAGCAAACAAATGTAGTGGGG + Intergenic
1076204371 10:128584336-128584358 CAGATGAAACAAATGTATTGAGG - Intergenic
1077801744 11:5545974-5545996 AGAAGCAAACAGTTGTCTTGGGG - Intronic
1079387359 11:19992438-19992460 AAAAGGAAAGAGCTGTATGGTGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079461445 11:20682565-20682587 AAAATTAAACAGGTTTATTGAGG + Intronic
1080048737 11:27836743-27836765 CACAGGAAACAGGTGAATTGTGG - Intergenic
1080118830 11:28651036-28651058 AAAAGGCAACAGATGTCTTTGGG - Intergenic
1080135392 11:28848256-28848278 TAGAGGAAACAGAGATATTGGGG + Intergenic
1080165477 11:29231305-29231327 AAAAGAAAACCAATGTAATGGGG + Intergenic
1080932741 11:36829802-36829824 CATAGGAAACATATGTGTTGAGG - Intergenic
1081072474 11:38628674-38628696 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1081590061 11:44416373-44416395 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1082283219 11:50293470-50293492 AAAAGGAATCAGAAGTATCAAGG + Intergenic
1082630568 11:55537457-55537479 AAAAAAAAAAAGCTGTATTGTGG - Intergenic
1082999305 11:59277114-59277136 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1085849864 11:80107712-80107734 CAAAGGAAATGGATGTGTTGTGG - Intergenic
1086138439 11:83466876-83466898 AAAAGGAAACTAATGTATGTAGG + Intronic
1086759158 11:90605353-90605375 AAAAAGAAGTAGATGAATTGAGG - Intergenic
1086939101 11:92777162-92777184 AAAACTAAACAGGTGTTTTGGGG - Intronic
1087445890 11:98253026-98253048 AATATGAAAGAGATTTATTGGGG + Intergenic
1087771476 11:102214973-102214995 AAAAGTATACACATGGATTGGGG - Intronic
1087828665 11:102794879-102794901 AGAAGGAAAGAGATCTTTTGGGG - Intronic
1087968760 11:104452946-104452968 AAATGGAGACACAGGTATTGAGG + Intergenic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1088357435 11:108958665-108958687 AAATGGAAAATGGTGTATTGGGG + Intergenic
1088371519 11:109093568-109093590 CCAAGGAAACAGATAAATTGTGG - Intergenic
1088580762 11:111313822-111313844 AAAAAGAAAAAAATTTATTGAGG - Intergenic
1089042469 11:115465481-115465503 AGAAGGAAATAAATGTATTTAGG + Intronic
1089187554 11:116629954-116629976 AAGAGGAAAGAGATAAATTGAGG - Intergenic
1089241886 11:117088461-117088483 AAAAGTCAAAAGATGTATTAAGG + Intronic
1090209975 11:124912205-124912227 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1090221921 11:125034026-125034048 AGAAGCAAACAGAGGTGTTGGGG + Intronic
1091326564 11:134693884-134693906 AAAAGAAAACAGTTATAATGTGG + Intergenic
1091425506 12:384887-384909 AAAAGAAAAAATATGCATTGCGG + Intronic
1093002260 12:14010652-14010674 AAAAGTAAAGAGATAAATTGAGG + Intergenic
1093206171 12:16253338-16253360 AAAAGGCAACATATGGAATGGGG + Intronic
1093301331 12:17460835-17460857 AATAGGAAGCAGATTTATTTTGG + Intergenic
1093680697 12:21998817-21998839 TAATGGAAACAAATGAATTGAGG - Intergenic
1094535748 12:31321695-31321717 GAAAAGGAACACATGTATTGAGG - Intronic
1094608247 12:31968391-31968413 AAAAGGAAACAGAAGTGGTCAGG + Intronic
1095303660 12:40615587-40615609 AAATGGAAGCATATTTATTGGGG - Intergenic
1095346142 12:41150426-41150448 AACAGGAAACTGTTGTGTTGTGG - Intergenic
1095433227 12:42157108-42157130 TAAAGAAAACAGATTTATTTTGG + Exonic
1096293231 12:50360378-50360400 AAAAAAAAACAGCTTTATTGAGG - Intronic
1097391303 12:59017872-59017894 TAAATCAAACAGATATATTGGGG + Intergenic
1098582976 12:72122785-72122807 AAAACGAAAAAGATATATTTGGG - Intronic
1098641213 12:72839893-72839915 AGGAGGAAGCAGATGTACTGTGG - Intergenic
1098674615 12:73273130-73273152 TACAGGAAAAAGATGTATTTTGG + Intergenic
1098730752 12:74034932-74034954 AGAAGCAAACAGGGGTATTGAGG - Intergenic
1098822941 12:75255821-75255843 AAAAGGAAATAGAAGAAATGGGG - Intergenic
1098973827 12:76881251-76881273 ATAAAGAAACAGATGCATAGAGG - Intergenic
1099310373 12:81013034-81013056 AAAAGAAAATATATTTATTGGGG - Intronic
1099379980 12:81941175-81941197 AGAAGCAAACAGGTGTGTTGGGG + Intergenic
1099664848 12:85614801-85614823 AAAAGGAAAAAGAAGTGTTTGGG - Intergenic
1099735459 12:86562622-86562644 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1099838024 12:87932599-87932621 AAAAGGAAACTGCTGTGTGGAGG + Intergenic
1100682957 12:96948950-96948972 AGAAGTCAACAGATGTCTTGAGG + Intronic
1101008168 12:100422669-100422691 AAAGAAAAACAGATTTATTGGGG - Intergenic
1101795766 12:107972061-107972083 AAAAGGAAAGAAATGTATAAAGG - Intergenic
1102426222 12:112846434-112846456 AAAGGGAAGCAGATGTCTTGGGG - Intronic
1102831107 12:116000599-116000621 AAAAGGAAAGAGTTGGATTTTGG - Intronic
1103035237 12:117651295-117651317 AGAAGCAAACAGGGGTATTGGGG - Intronic
1103248117 12:119475672-119475694 AAAGTGAAACAGTTGTATGGGGG - Intronic
1103313438 12:120031591-120031613 AAAAGGAAACTGAAGTATGTAGG - Intronic
1103632508 12:122273636-122273658 AAAAAAAAACAAATGTTTTGTGG - Intronic
1104084955 12:125466000-125466022 TAAAGAAAATAGATTTATTGTGG - Intronic
1104202710 12:126607288-126607310 AAGAGGAAACATATTTATTTTGG + Intergenic
1105302435 13:19148279-19148301 AAGAGGAAAGAGATAAATTGAGG - Intergenic
1106293454 13:28388015-28388037 AAAAGCAAACAGAATGATTGAGG - Intronic
1106516271 13:30456996-30457018 AAAAGAAAAAATATGTATTATGG + Exonic
1106684724 13:32046180-32046202 AAAAGGATAGAGATAAATTGTGG + Intronic
1106925268 13:34606859-34606881 GAAAAGAAAGAGATATATTGAGG + Intergenic
1107472671 13:40704901-40704923 AAAAGAAAAGAGATTTATTTTGG - Intergenic
1107937490 13:45357349-45357371 CAAAGGAAGCAGATGTCCTGTGG + Intergenic
1108120050 13:47175774-47175796 AACAGGAAACACATTTATAGTGG + Intergenic
1109643822 13:65226090-65226112 AAAAGGAGAGAGAGGTATTGAGG + Intergenic
1109873362 13:68365888-68365910 GAAAGGATAGAGATGAATTGAGG - Intergenic
1109886060 13:68546821-68546843 AAATGGAAAAAAATGTATGGAGG + Intergenic
1109951331 13:69504597-69504619 AAAAGCAAACAGAGGTGTTGGGG + Intergenic
1110104917 13:71660479-71660501 TAAAGTAAGCAAATGTATTGGGG + Intronic
1110284932 13:73738904-73738926 GAAAGGAAACTGAGGCATTGAGG - Intronic
1110518716 13:76448352-76448374 TATATAAAACAGATGTATTGGGG - Intergenic
1110623774 13:77628853-77628875 AGAAGGAAGAAGATGTTTTGGGG - Intronic
1110658685 13:78032369-78032391 AACAGGAAACACCTGTATGGTGG + Intergenic
1110665347 13:78110685-78110707 AAAAGAAAAGACATATATTGGGG - Intergenic
1111016498 13:82388259-82388281 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1111366262 13:87249835-87249857 AAAAGGAAAGAGATGTATTTTGG + Intergenic
1111783811 13:92762937-92762959 AAAAGGAAACAGAAATCTTGGGG - Intronic
1111790110 13:92844492-92844514 AAATGCAAAAAGATGTATTAAGG - Intronic
1113503616 13:110797933-110797955 AAAAGGAAATACATATATTTAGG + Intergenic
1114301732 14:21384720-21384742 CAGAGGAAACAGATGACTTGAGG + Intergenic
1114592191 14:23876429-23876451 AAAAGAAGACAGAAGTAATGGGG - Intergenic
1114758572 14:25286161-25286183 AAAAGCAAACAGAGGTGTTGGGG + Intergenic
1115425269 14:33251555-33251577 AAAAGTAAACAGTTGGATTAAGG - Intronic
1115860721 14:37683130-37683152 AAAAGGAAACATGTTTTTTGAGG + Intronic
1115922002 14:38385330-38385352 AAAAAAAAACATATTTATTGAGG - Intergenic
1116064779 14:39969361-39969383 AAAATGAAAAAGATAAATTGAGG + Intergenic
1116185556 14:41596436-41596458 AGAAGAAAACAGCTTTATTGAGG + Intergenic
1116847784 14:49880811-49880833 CAAATGAAAGAGATGGATTGGGG + Intergenic
1117085239 14:52194100-52194122 ACAAGGAACCATATGTATGGTGG - Intergenic
1117216502 14:53557669-53557691 AGAAGCAAACAGAGGTGTTGAGG - Intergenic
1117416765 14:55503906-55503928 AAAAGTAAATAAATGTAATGTGG + Intergenic
1117729616 14:58709120-58709142 ATAAGGAAACAGATCCATAGAGG - Intergenic
1117964466 14:61192573-61192595 AAAAGGAAACGGCTGCAGTGTGG + Intronic
1118570763 14:67192573-67192595 AAAAAGAAACAGATGGTTTCTGG - Intronic
1119309896 14:73637103-73637125 AAAAGAAAACATCTGTTTTGTGG - Intergenic
1119375136 14:74184905-74184927 AAAAGAAAAAAGATGTACTAGGG - Intronic
1119553516 14:75535440-75535462 AAATGAAAACAGCTGTATTAAGG + Intronic
1119889590 14:78172987-78173009 ATAAGGGAAAGGATGTATTGAGG + Intergenic
1120322484 14:82981957-82981979 AAAAAAAAAAAGATGTATTTTGG + Intergenic
1120421407 14:84290803-84290825 AACAGGAAACAGATGGACTATGG - Intergenic
1120458736 14:84766096-84766118 AAAAGGAAACCTATGAAATGAGG + Intergenic
1121165520 14:91792812-91792834 AAAGGGAAAAAGCTGTATTGTGG - Intronic
1121197961 14:92091633-92091655 TAAAAAAAACAGATTTATTGGGG + Intronic
1121705537 14:95990500-95990522 AGAAGAAAACAAATGTTTTGTGG - Intergenic
1122554183 14:102568192-102568214 AAAAGGAAAAAAAAGTAGTGGGG + Intergenic
1124069428 15:26377929-26377951 AAAAGGAAATAGATGTCTCCTGG + Intergenic
1124127168 15:26946420-26946442 AAAAAAAAACAGATAAATTGAGG - Intronic
1124552264 15:30692798-30692820 AGAAGGAATCAGATGTAGGGAGG + Intronic
1124678975 15:31712868-31712890 AGAAGGAATCAGATGTAGGGAGG - Intronic
1124828475 15:33124230-33124252 AAAAGGAAACAGATGTTATGTGG + Intronic
1125857250 15:42962330-42962352 AAAAGGAAACAGCGGTATCATGG + Intronic
1126867003 15:52947679-52947701 AAAAGGAAAAGGAAGTATTGAGG + Intergenic
1127068820 15:55268138-55268160 AAAAAAAAAAAGATGTTTTGGGG - Intronic
1127298874 15:57633384-57633406 AAAGGGAAAAAAATGTAGTGAGG + Intronic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1128824736 15:70703373-70703395 AGTAGGAAACAGATTTCTTGTGG - Intronic
1129961714 15:79692495-79692517 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1130324545 15:82869158-82869180 AGAAGAAAACAGCTTTATTGAGG - Intronic
1131189774 15:90304975-90304997 AAAAGGAATTAGATATATAGTGG - Intronic
1131226057 15:90625136-90625158 AAATGGAAACAGATGGTATGCGG + Intronic
1131335054 15:91540941-91540963 AACAGGAAACTGATATTTTGAGG + Intergenic
1131345261 15:91641412-91641434 AAGGGCATACAGATGTATTGAGG - Intergenic
1131534210 15:93220891-93220913 AAAAGGAAAAAGATTTCTGGGGG - Intergenic
1131543978 15:93300147-93300169 AAAAGGAAACAGACATGCTGAGG - Intergenic
1131616317 15:94020461-94020483 AAAAAGAAACAGCTGAAGTGGGG + Intergenic
1132374381 15:101319110-101319132 GAAGGGAAACAGATGTAGAGGGG - Intronic
1133042722 16:3069009-3069031 AAAAAGAAAGAGATGGATTACGG + Exonic
1133044766 16:3081652-3081674 AAAAAGAAAGAGATGGATTACGG + Intronic
1133484532 16:6206613-6206635 AAAAGTTAAAAAATGTATTGTGG - Intronic
1133728013 16:8555272-8555294 AGAAGAAAACAGCTGTATTGAGG + Intergenic
1134368455 16:13601284-13601306 AAAAGGAAACAGGTTGACTGGGG - Intergenic
1134535592 16:15024398-15024420 AAAAATAAACAGAAGAATTGGGG - Intronic
1134632138 16:15764342-15764364 AAATCAAAACTGATGTATTGGGG + Intronic
1135258185 16:20958516-20958538 AAAAGCAAAGAGAGGTATTAAGG - Intronic
1135496317 16:22954613-22954635 AAAATAAAACAAATGTAATGTGG + Intergenic
1135899406 16:26443061-26443083 AAAAGAACACAAATGGATTGTGG + Intergenic
1136155458 16:28379207-28379229 AGAAAGTCACAGATGTATTGAGG - Intergenic
1136207626 16:28736082-28736104 AGAAAGTCACAGATGTATTGAGG + Intergenic
1137413031 16:48245180-48245202 AAAGGGAAACAGAAGGATTAGGG - Intronic
1137846812 16:51697897-51697919 AGAAGAAAACAGCTTTATTGAGG + Intergenic
1137911450 16:52382169-52382191 AAAAGGGAAGAGAGGTATAGAGG + Intergenic
1138217513 16:55217508-55217530 AAAAGCAAACAGCTGTGTTGTGG - Intergenic
1138911654 16:61407688-61407710 AAAAGGAAACAATTGTCTTAAGG - Intergenic
1139827967 16:69772478-69772500 AGAAGAAAACAGCTTTATTGAGG + Intronic
1139860449 16:70016379-70016401 AAAAATAAACAGAAGAATTGGGG + Intergenic
1139944403 16:70629686-70629708 AAAAAGAAAAAAATGTAGTGAGG - Intronic
1140392098 16:74596225-74596247 AAAAGAAAAAAAATTTATTGTGG + Intronic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1143943350 17:10566767-10566789 AAAAGAAAACTGTTGTTTTGGGG + Intergenic
1144035744 17:11363997-11364019 AGAAGGAAACAGCTTTATTGAGG - Intronic
1144134692 17:12282032-12282054 AAAAGGATACTGATGGAATGGGG + Intergenic
1144138597 17:12322995-12323017 AAAAGAAGGTAGATGTATTGGGG + Intergenic
1144152731 17:12465790-12465812 AGAAGGAAACAGCTTTATTAAGG - Intergenic
1144246463 17:13370904-13370926 AAAAGAACGCAGATGTAATGAGG + Intergenic
1146114271 17:30120635-30120657 AAAAGGAAACTAATATACTGAGG + Intronic
1146598933 17:34195712-34195734 AAAAAAAAACAGCTTTATTGAGG + Intergenic
1146780384 17:35665833-35665855 AGAAGCAAACAGATGTACTTTGG + Intronic
1147035024 17:37673465-37673487 AAAAGCAAACAGATGGATTATGG - Intergenic
1147057841 17:37847785-37847807 AAAAAGAAACAGCCTTATTGAGG + Intergenic
1147228048 17:38996158-38996180 AAAAGGATAAAGATTTACTGTGG - Intergenic
1148616138 17:49000825-49000847 AAAAGCAAGCAGATGGCTTGGGG - Intronic
1149777515 17:59369813-59369835 AAAAGGAAACAGCTCTTTGGAGG + Intronic
1149819767 17:59764752-59764774 AAAAAAAATCAGATTTATTGAGG - Intronic
1149916206 17:60612046-60612068 AAAAGAAAACAGATTTATAGAGG + Intronic
1150193428 17:63268122-63268144 GAAAGAAAACAGATGTAAAGGGG + Intronic
1150417030 17:64996079-64996101 AAAAGAAAACAACTGTATTTAGG - Intergenic
1151735840 17:75939930-75939952 AAAAGAAAACACATGTATTCAGG - Intronic
1152150109 17:78593984-78594006 AAAAAGAAAAAAATATATTGTGG - Intergenic
1152669065 17:81590681-81590703 AAACTGAAATAGAGGTATTGAGG - Intronic
1153296700 18:3553059-3553081 AAAAGGATACACATGTATCTTGG - Intronic
1154068150 18:11128698-11128720 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1155374255 18:25138746-25138768 AAAAGGAAACTGAGGAACTGAGG + Intronic
1155902038 18:31403435-31403457 TACAGGAACCATATGTATTGAGG + Exonic
1156032090 18:32724423-32724445 AAGAGTAAAGACATGTATTGAGG - Intronic
1156069355 18:33187479-33187501 AGAAGGAATGAGATGTATTGAGG - Intronic
1156192363 18:34734149-34734171 AGAAGCAAACAGAGGTATTGAGG + Intronic
1156244884 18:35288943-35288965 AAAACAAAACAGCTTTATTGAGG - Intronic
1156289976 18:35739051-35739073 AAAAGGAAATAAATGTGTTAAGG + Intergenic
1156700540 18:39819385-39819407 AAAAGGAAAGAGAGTTATTTGGG - Intergenic
1157479804 18:48046315-48046337 AGATGGAAGCAAATGTATTGAGG + Intronic
1158793847 18:60817487-60817509 AAAAGGAAAAAAATTTATTCTGG + Intergenic
1159287476 18:66373028-66373050 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1159410461 18:68068301-68068323 AAATAAAAACTGATGTATTGTGG - Intergenic
1159902519 18:74060887-74060909 AGAAGAAAACAGCTTTATTGAGG - Intergenic
1164540880 19:29120751-29120773 AAGAGGAAACAAATATTTTGAGG - Intergenic
1165914961 19:39252865-39252887 TGGAGGAAACAGATGAATTGTGG + Intergenic
1166801757 19:45462155-45462177 AAAAGGAAACTGAGGTACAGGGG - Intronic
925360960 2:3280090-3280112 AAGAGGAAAGGGATGTGTTGTGG + Intronic
926248200 2:11136632-11136654 AAATGGACACAGGTGTTTTGGGG + Intronic
926257420 2:11219175-11219197 AAAATGATACAAATGTCTTGAGG - Intronic
926838965 2:17057434-17057456 AAAAAGAAACAAATGTACTTTGG - Intergenic
926897893 2:17714623-17714645 ACAGGGAAACAGATGTAGTATGG - Intronic
926952091 2:18253975-18253997 AAAAGGAAAAAGTGGTTTTGTGG + Intronic
927587731 2:24323776-24323798 ATAAGGAAACTAATTTATTGAGG - Intronic
927856464 2:26530678-26530700 GAAAGAAAACAGATGTGGTGAGG - Intronic
927869920 2:26616864-26616886 AAGAGCAAACAGAAGTCTTGGGG + Intronic
928488698 2:31758540-31758562 AAAAGGAACATGATATATTGAGG + Intergenic
928536371 2:32245325-32245347 AAAAAAAAACAGATGAATAGAGG + Intronic
929164957 2:38872983-38873005 AAAAAAAAAAAAATGTATTGAGG - Intronic
930188281 2:48431828-48431850 AAAACAAAACATGTGTATTGAGG - Intergenic
930330304 2:49975009-49975031 CACTGGAAACAGATGTATTTGGG - Intronic
930993962 2:57693984-57694006 AAAAAGAAAAAAATGTATGGAGG + Intergenic
931047144 2:58367226-58367248 AAAAGTGAACAGATGTATTTTGG - Intergenic
931521963 2:63107481-63107503 AAAATGAAACCGATATATTGAGG + Intergenic
932289526 2:70564934-70564956 AAAGCGAAATAGATTTATTGTGG - Intergenic
933049744 2:77589116-77589138 ATAAGGAAATGGATATATTGTGG - Intronic
933064210 2:77773275-77773297 AGAAGGAAAAAGTTGTTTTGTGG - Intergenic
933539687 2:83623147-83623169 AACAGGAAACAGACTTATTGAGG - Intergenic
934962337 2:98687678-98687700 AAAAGGAGACAGGGCTATTGTGG - Intronic
935190520 2:100774621-100774643 CAAAGAAAACAGTTGTACTGAGG + Intergenic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
936640969 2:114312590-114312612 AGAAGCAAACAGGGGTATTGCGG - Intergenic
936941159 2:117885851-117885873 ACAAGGAAACAGAGGTAAAGAGG - Intergenic
936993825 2:118393144-118393166 AAGAGGAAATAAATGCATTGTGG + Intergenic
937777422 2:125795440-125795462 AAAAAAAAAAAGATGTAGTGTGG + Intergenic
937852880 2:126651156-126651178 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
937918157 2:127109816-127109838 TAAAGGAAGCAGATGTGTTAGGG + Intergenic
939183995 2:138839360-138839382 AACAGGAAACAGATGTAGAGAGG + Intergenic
939324769 2:140673919-140673941 AAAAGAAAAGAGATATATTTCGG - Intronic
939772475 2:146338615-146338637 ATAAGGTAACAGATGTAGTCTGG - Intergenic
939937994 2:148315388-148315410 TAAAACAAACAGATGTATTTTGG - Intronic
940257988 2:151751865-151751887 ACAATGAAACAGATTGATTGAGG - Intergenic
940461745 2:153972593-153972615 AAAATGCTACAGATGAATTGGGG + Intronic
940776529 2:157890414-157890436 GAAAGGACACAGAGGCATTGAGG + Intronic
941329950 2:164167849-164167871 AAAAGGAAACAAATCTGGTGAGG - Intergenic
941367336 2:164623356-164623378 AAAAGCATACAGATATACTGAGG + Intergenic
941741855 2:169044053-169044075 AAAAGGAAAAAGCTGTTTTGTGG + Intergenic
941863295 2:170307668-170307690 GAAAGAAAACAGCTTTATTGAGG + Intronic
942681553 2:178481824-178481846 AACAGTAAACAGATTTTTTGGGG + Intronic
943030554 2:182680779-182680801 AGAAGAAAACAGCTTTATTGAGG + Intergenic
943483324 2:188449429-188449451 CAAAATAAATAGATGTATTGGGG - Intronic
943509161 2:188802852-188802874 AGAAGCAAACAGAAGTGTTGGGG - Intergenic
943732936 2:191322282-191322304 AGAAGGAAACATCTGTCTTGAGG - Intronic
943765244 2:191654058-191654080 CAAAGGAAATAAATGTTTTGAGG - Intergenic
943868641 2:192962779-192962801 AGAAGAAAACAGCTTTATTGAGG + Intergenic
944123017 2:196261845-196261867 AAAAGGAAAAAGAAATATTGCGG - Intronic
945190041 2:207178472-207178494 AAAAGAAAAGAGATGTATTTTGG - Intergenic
945471775 2:210235263-210235285 AAAAGGTAACGGATATAATGGGG + Intergenic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
946058861 2:216924450-216924472 AGAAGAAAACAGCTTTATTGAGG - Intergenic
946244919 2:218382048-218382070 GAAGGGGAACAGATGTGTTGTGG + Exonic
946514894 2:220401357-220401379 TAAAGGAAAGAGATGTTTGGGGG - Intergenic
946778520 2:223169329-223169351 CAAAAGAAACCGATTTATTGCGG + Intronic
946942175 2:224780900-224780922 AAAAAAAAAAAAATGTATTGCGG + Intronic
1170191631 20:13650649-13650671 ACAAGGAAACAGATGCCTTATGG - Intergenic
1170662751 20:18358841-18358863 AAAAGCATACAGATGTTTTCAGG - Intergenic
1170679740 20:18515621-18515643 AGAAGGAAACAGTTTTATTAGGG - Intronic
1170793187 20:19524653-19524675 AAAAGGAAATACATGAAGTGGGG - Intronic
1171049694 20:21843888-21843910 AAAAGCAACCATATATATTGGGG + Intergenic
1173048611 20:39537049-39537071 AAATGGAAACAGCTTTATTTGGG - Intergenic
1173481189 20:43400800-43400822 AAAACAAAACACATGTGTTGTGG - Intergenic
1173845031 20:46182808-46182830 ACAAAGAAACAGATGGGTTGGGG + Intronic
1173923154 20:46760921-46760943 AAATGTAAACAGATGAAATGAGG - Intergenic
1174035771 20:47667515-47667537 GAAAGGAAACAGATGTCTCACGG + Intronic
1175050308 20:56149556-56149578 AGAAGGAAACTGAGGTATAGAGG + Intergenic
1175138103 20:56840064-56840086 AGAAGAAAACAGTTTTATTGAGG + Intergenic
1175675449 20:60942837-60942859 AGAAGAAAACAGCTTTATTGAGG - Intergenic
1175821513 20:61912369-61912391 AAAAGGAAAAAGATGACTTTGGG - Intronic
1177002946 21:15635980-15636002 AAAAGCAAACAGAGGTGTTGAGG + Intergenic
1177383011 21:20370099-20370121 AAAAGGAAATAGCTCTGTTGTGG - Intergenic
1177455752 21:21335757-21335779 AAGAGGAAACAGATTTAATATGG - Intronic
1177559458 21:22731018-22731040 AAAAGAAAAAAGCTTTATTGTGG + Intergenic
1178380358 21:32102546-32102568 AGTAGGAAACAGATGGTTTGTGG - Intergenic
1178622655 21:34189976-34189998 AAAAAGAAATTGATGTATTAGGG - Intergenic
1178768240 21:35475767-35475789 AAAAGATAACAGATGTGTTGGGG + Intronic
1179897979 21:44373699-44373721 AAAAGGAAAGAGAGAAATTGAGG - Intronic
1182989203 22:34750892-34750914 AAAAGGAATCAGATTTGTTAGGG + Intergenic
1183594144 22:38799799-38799821 ATAAAGAAACAGATGTGATGAGG + Intergenic
1183848178 22:40560750-40560772 AGAGGGAAACAGATGGGTTGTGG - Intronic
949201361 3:1383665-1383687 AAAAAAAAACAGCTTTATTGAGG + Intronic
949675571 3:6449172-6449194 ACAAGGAAACAGAAGAATTAGGG + Intergenic
950233140 3:11294212-11294234 AAAAGAAAACAGGTGATTTGAGG - Intronic
950233287 3:11295301-11295323 AAAAGCAAACAGAAGGAATGAGG - Intronic
950685055 3:14610981-14611003 AGAAGAAAACAGCTTTATTGAGG + Intergenic
950939394 3:16878173-16878195 AAAACAAAACAGATGTATAAAGG + Intronic
951057950 3:18169645-18169667 AAAAGGAAATGGATGACTTGCGG - Intronic
951118077 3:18888933-18888955 AGAAGGAAACAGATTTTTTGGGG + Intergenic
951384222 3:22025322-22025344 ACAAGCAAACAGAGGTTTTGGGG - Intronic
951444778 3:22765732-22765754 AAGAGGTAACAGATACATTGTGG + Intergenic
951579087 3:24143238-24143260 AAAAGCAAACTGATATAATGTGG + Intronic
952689140 3:36183261-36183283 AAAAGGAACCATATATAATGAGG - Intergenic
952839491 3:37632148-37632170 AAAAGGAAACAAATGATTTAGGG + Intronic
953973364 3:47364206-47364228 AAAAAGTTGCAGATGTATTGTGG - Intergenic
953986396 3:47446473-47446495 AAAAGTAAACATAAGAATTGAGG - Intronic
956100662 3:65764667-65764689 AAAAGGAAGCTGATTTATGGTGG - Intronic
956509323 3:69977921-69977943 AAAAGCAAACAGGGGTGTTGGGG - Intergenic
957247853 3:77735772-77735794 ACAAGCAAACAGAGGTGTTGGGG + Intergenic
957897805 3:86446310-86446332 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
958050036 3:88333481-88333503 AAGAGGACACAGAGGTAATGGGG + Intergenic
958430783 3:94038465-94038487 AGAAAGAAACACAAGTATTGTGG - Intronic
958718561 3:97818161-97818183 AAAAGCAAGCAGATGGATTGGGG - Intergenic
959365835 3:105456244-105456266 AGAAGAAAACAGTTGTATCGAGG - Intronic
959912610 3:111780543-111780565 TAAAGAAAACAGATTTATTTTGG - Intronic
960125800 3:113997161-113997183 ATAAGTAAACAGATGAATTGTGG + Intronic
960292196 3:115899139-115899161 AAACAGAAGCAGATGTATTCAGG + Intronic
960452356 3:117826286-117826308 AAAACAAAACAGATGTTTGGAGG - Intergenic
961111156 3:124284273-124284295 AAAGGGCAAAAGATGCATTGGGG - Intronic
961128543 3:124443963-124443985 AAAAGGAAACTGATATATAAGGG - Intronic
962177342 3:133168101-133168123 AAAAGGGAAGGGATGTAATGAGG + Intronic
962282733 3:134064520-134064542 AAAAAAAAACAGTTTTATTGAGG + Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963422863 3:145083832-145083854 AACAGAAAACAGATCCATTGTGG - Intergenic
963432673 3:145229785-145229807 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
963490249 3:145991058-145991080 AGAAAGAAACAAATGTCTTGGGG - Intergenic
963871209 3:150415990-150416012 ATTAGGAAACAGATTTATTTGGG - Intronic
964050827 3:152391177-152391199 AAAAGCAGAAAGATGTATTCAGG - Intronic
964408192 3:156371643-156371665 AAAAGAAACCAGAGGAATTGGGG + Intronic
964690822 3:159447835-159447857 AAAAGGAAAAAAATTAATTGTGG - Intronic
965034860 3:163424934-163424956 AGAAGAAAACAGGGGTATTGGGG + Intergenic
965042257 3:163524176-163524198 AAAAGCAATCAGGTTTATTGAGG - Intergenic
965120004 3:164542112-164542134 AAAAAAAAACAGATGGATTCTGG + Intergenic
966045303 3:175541643-175541665 AAAAGGAAACAAGTGTATCTTGG - Intronic
966286979 3:178309028-178309050 AAAAGAAAACAGCTTTATTGAGG + Intergenic
966457810 3:180137498-180137520 AAAAGGAATGAGATATATTTTGG - Intergenic
967028260 3:185583112-185583134 AAAAAGAAAGAAATATATTGGGG - Intronic
967245335 3:187480850-187480872 ATAAGGAAAAAAATATATTGGGG + Intergenic
967728787 3:192887515-192887537 AAAAGGAAAAAGATATATTTAGG + Intronic
967831445 3:193923535-193923557 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
969648796 4:8450659-8450681 ATAAACACACAGATGTATTGGGG - Intronic
970184376 4:13434161-13434183 AAGAGGAGACAGATGGAGTGGGG + Intronic
970547737 4:17146978-17147000 AAAAGGAAACTGATGTTTAGAGG + Intergenic
971325273 4:25638357-25638379 AAAAAAAAAAAGATGTGTTGTGG - Intergenic
971425628 4:26512404-26512426 AGAAGAAAAAAGATTTATTGGGG + Intergenic
971584394 4:28386790-28386812 AAAAGGAAAGAGATAAATTAAGG - Intronic
971777177 4:30981214-30981236 ACAAGGAAACAGAGGAATGGGGG - Intronic
972054944 4:34789849-34789871 AATATGAAACTGATGTACTGAGG + Intergenic
972461610 4:39308871-39308893 AAAAGGAAACAGATGTGTTTTGG - Exonic
973616626 4:52685435-52685457 TAAAGGAAAGAGATTTATTTTGG + Intergenic
973744948 4:53955143-53955165 ACAAGGAAACTGAGGTATTGTGG + Intronic
973842530 4:54876596-54876618 GGAAGGAAACAGCTTTATTGAGG + Intergenic
974145550 4:57943184-57943206 AAAAGGAGACAGTTGAATAGCGG + Intergenic
974300064 4:60052448-60052470 AAAATGAAAAAGAAGTATTAAGG - Intergenic
974510700 4:62836694-62836716 AAAAGGTAACAAAAGTGTTGTGG - Intergenic
975019437 4:69468466-69468488 AAAAGGAAAGAGATAGTTTGGGG + Intergenic
975050752 4:69861722-69861744 AAAAACAGACAGATGTATTGAGG - Intergenic
975315878 4:72952739-72952761 ATAAAGAAACAGAAGTACTGGGG - Intergenic
976151120 4:82093011-82093033 AAAAGGAAAATGATATATTTTGG + Intergenic
976777519 4:88722322-88722344 AAAAAGAAACAGATTTCTGGAGG + Intergenic
977080221 4:92517548-92517570 AAAAGGAAACAGAAGATATGAGG - Intronic
977330828 4:95635236-95635258 AAAAGGATGCAGAAGCATTGTGG + Intergenic
978158875 4:105521904-105521926 AAAAGAAAACAAATGAATTAAGG - Intergenic
978178706 4:105766704-105766726 AGAAGGAAACAGATAAATTAAGG - Intronic
978717227 4:111859856-111859878 AAAGGTAAACAGATATTTTGAGG - Intergenic
978785846 4:112608771-112608793 AAAAGAAAACACCTGTATTATGG - Intronic
978856867 4:113403563-113403585 AAATGGAAACTGATGAATAGAGG + Intergenic
979028392 4:115606543-115606565 ACAAATAAACAGATGTAATGAGG + Intergenic
979482154 4:121231776-121231798 AAAAGGATACAGATATGGTGAGG - Intergenic
979515944 4:121610415-121610437 AAAAGGGAAAAGATGAAATGTGG - Intergenic
979935001 4:126682262-126682284 CAGAGAAAACTGATGTATTGAGG + Intergenic
980621499 4:135312205-135312227 AAAGGGAAGAAGATGTATTGAGG + Intergenic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
981390748 4:144188669-144188691 AAAAGGGCACAAATGTATTTTGG - Intergenic
981601251 4:146491526-146491548 AAAAGGAAAAAGATGGAGGGAGG + Intronic
981834540 4:149040017-149040039 AGAAGCAAACAGAGGTGTTGCGG - Intergenic
981901763 4:149873744-149873766 TAAAGGAAAGAGATTTATTCTGG + Intergenic
983063544 4:163184853-163184875 CAATGAAAACAGATGTTTTGTGG + Intergenic
983709651 4:170697924-170697946 AATGAGAAACAGAAGTATTGTGG - Intergenic
983731162 4:170995382-170995404 AAAAGGAAACAGATGGATCATGG - Intergenic
984167914 4:176325021-176325043 AAAAGGAAACAGCTGAGTGGTGG - Intronic
984173065 4:176384331-176384353 AGAAGGAAACAGATGTACCCAGG + Intergenic
984421825 4:179533228-179533250 AAAAGGATACCGATCTTTTGTGG - Intergenic
985157510 4:187005621-187005643 AAAAGAAAATATATGTATGGAGG + Intergenic
986678704 5:10214007-10214029 AAAAAAAAACAATTGTATTGGGG + Intergenic
986742670 5:10717662-10717684 ATTAGCAAACAGAGGTATTGGGG - Intronic
986835627 5:11633967-11633989 AAATAGAAACAGATGTCATGAGG - Intronic
987197885 5:15545803-15545825 AAAAAGTAAAAGATGTATTAGGG + Intronic
987565733 5:19583631-19583653 GCAAGGAAAAAGAAGTATTGAGG + Intronic
987657432 5:20824076-20824098 AAAAGCAAACAGAGGTGTTGTGG + Intergenic
987764701 5:22210539-22210561 ATAAGTAAACATGTGTATTGGGG + Intronic
987869128 5:23590053-23590075 AAAAGCAGACAGATGTTTAGAGG - Intergenic
988326157 5:29770758-29770780 AAAAGGAGGAAGATGTAATGAGG - Intergenic
988617513 5:32789675-32789697 AAAAGGAAAGTGATGCATTTGGG - Exonic
988766114 5:34379870-34379892 AAAAGCAAACAGAGGTGTTGTGG - Intergenic
989555750 5:42792670-42792692 ACAAGGAAACAGGTATAATGGGG - Intronic
990156002 5:52877959-52877981 AACAGAAAGCAGATGAATTGGGG + Intronic
990631467 5:57674789-57674811 AAAATAAAAGAGATTTATTGGGG - Intergenic
991899440 5:71443688-71443710 ATAAGTAAACATGTGTATTGGGG + Intergenic
992180422 5:74191695-74191717 AAAAGGAAATAGAAGTATACAGG - Intergenic
992810369 5:80381338-80381360 AAAAGGAAACAGATTGACTAAGG + Intergenic
993319528 5:86456165-86456187 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
994238298 5:97391440-97391462 AGAAGAAAACAGCTATATTGAGG - Intergenic
994289968 5:98017523-98017545 AAGAGAAATCAGATGTATTTTGG - Intergenic
994632275 5:102300762-102300784 AAAAGGAGAAAGCTGTATAGAGG + Intergenic
994984730 5:106918166-106918188 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
995499219 5:112785066-112785088 AAAAGAAAACAGAAATAATGAGG + Intronic
995584767 5:113636761-113636783 AAAATGAAACAGTAGTATTTAGG + Intergenic
996825243 5:127675375-127675397 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
996904336 5:128580545-128580567 AAAAGGAAAAAAATGTACTTTGG + Intronic
997273093 5:132557920-132557942 AAAATGTAACTGATGTAGTGGGG + Intronic
997574494 5:134963812-134963834 AAAAAAAAACAGAGGTACTGTGG - Intronic
998121788 5:139584499-139584521 AAAAAGAAAAAGGTGTTTTGGGG - Intronic
998837856 5:146220755-146220777 AAAAGAAAACATCTGTACTGGGG - Intronic
999866013 5:155701306-155701328 AAGAGGAAACAGAGGTTCTGGGG - Intergenic
999904221 5:156121735-156121757 AAAAGGGAAGAGATGCATTTAGG - Intronic
999956463 5:156708587-156708609 ACATACAAACAGATGTATTGAGG + Intronic
1000068047 5:157713386-157713408 GAAAGGAAACAAATGTTGTGGGG - Intergenic
1000279972 5:159773736-159773758 AAAAAAAAACAGATGTGATGTGG + Intergenic
1000697472 5:164405564-164405586 AAAAGGACACAGAAGTTTGGAGG + Intergenic
1001135869 5:169102177-169102199 AAAAGGAAACATGTGTGTTGGGG + Intronic
1001925973 5:175637473-175637495 AAATGCAAATAGATTTATTGAGG + Intergenic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1003161697 6:3641014-3641036 AAAAGGAAATAGTTCTACTGGGG + Intergenic
1003696226 6:8408539-8408561 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1003787358 6:9501535-9501557 AAAAGAAAACAGCTTTACTGAGG - Intergenic
1003888467 6:10542330-10542352 TAAAGGTAACAGGTTTATTGAGG + Intronic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004602164 6:17160768-17160790 ATAAGGAATCAGATCTATTAGGG + Intergenic
1004824617 6:19405670-19405692 AGAAGCAAACAGGAGTATTGGGG + Intergenic
1005328772 6:24728696-24728718 AAAAGGAAACATAATAATTGAGG + Intergenic
1005723697 6:28628118-28628140 ACAAAAAAACAGATTTATTGAGG - Intergenic
1006061035 6:31419522-31419544 AAGAGGAAAGAAATGTATTAAGG + Intergenic
1007140865 6:39572494-39572516 AAAAGGATCCAGATGTTTAGAGG + Intronic
1007670920 6:43552961-43552983 AAGAGGAAACAGATTTAGAGAGG - Intronic
1008107650 6:47456910-47456932 GAAAGGAGACAGATGGATTTGGG + Intergenic
1008439128 6:51512318-51512340 AAAAGGAAACAGTTTGAATGTGG + Intergenic
1008527147 6:52418678-52418700 AACAGGAAACAGATGTAGTAAGG + Intergenic
1008795156 6:55293955-55293977 AAAAAGAAAAAAAAGTATTGAGG + Intergenic
1008953122 6:57182540-57182562 AAAAAAAAAAAGATGAATTGAGG + Intronic
1009697676 6:67130404-67130426 AAAAAGAGATATATGTATTGAGG - Intergenic
1009732614 6:67629331-67629353 TAAAGGAATGAGATGAATTGAGG + Intergenic
1010106704 6:72178639-72178661 ACAAAGAAACAGAGGTACTGAGG + Intronic
1010108852 6:72200700-72200722 AAAAGGAGACATATGACTTGGGG + Intronic
1010254362 6:73740893-73740915 GAAAGGAAACAAATGTTTTGGGG + Intronic
1010690334 6:78903492-78903514 AAAAAGAAAAAGATGTATTAGGG + Intronic
1010880008 6:81155337-81155359 AAATGGAAAAAGATGTTTTATGG + Intergenic
1010938470 6:81888147-81888169 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1011039676 6:83015701-83015723 AGAAGCAAACAGAGGTATTGGGG + Intronic
1011068775 6:83359252-83359274 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1011103047 6:83745485-83745507 AAAAGGAAACAGATGACTGTAGG + Intergenic
1011487150 6:87854558-87854580 ATAAGGAAATAGATACATTGTGG + Intergenic
1011605153 6:89096314-89096336 ACAAGGAAACAGATGCAGAGAGG - Exonic
1011821570 6:91258795-91258817 AAGAGGAAACAGAGATAGTGTGG - Intergenic
1012004226 6:93692504-93692526 AAAAGGACACAGATCTTTTATGG - Intergenic
1012092510 6:94917608-94917630 AAATGGTAGCAGATGGATTGGGG + Intergenic
1012185866 6:96216222-96216244 AAAAGGAAAAAGAAGAATTAAGG - Intergenic
1012259159 6:97067574-97067596 AAAGGGAACCACATATATTGAGG + Intronic
1012803072 6:103858761-103858783 AGAAGGAAACATATTTAGTGAGG + Intergenic
1012820489 6:104080489-104080511 AGAAGCAAACAGAGGTATTGGGG - Intergenic
1012921114 6:105221920-105221942 AGAAGCAAACAGGAGTATTGGGG + Intergenic
1013151866 6:107453960-107453982 AGAAGGAAACAAATGACTTGTGG - Intronic
1013177275 6:107688601-107688623 AATAAGAAACAGATTTTTTGGGG + Intergenic
1013729448 6:113146909-113146931 AAAAAGAAAGGGAGGTATTGAGG + Intergenic
1013772765 6:113645962-113645984 AAAAAGAAAAAAATGTATTAAGG - Intergenic
1014456163 6:121637048-121637070 AGAAGCAAACAGAGGTGTTGAGG + Intergenic
1014669775 6:124287556-124287578 AAAATGAAATAGATGTTTTCAGG + Intronic
1015186943 6:130428358-130428380 AGAAGGAGAAAGTTGTATTGGGG - Intronic
1015301862 6:131661832-131661854 AAAAGGCAACATATGAAATGGGG - Intronic
1015606468 6:134960873-134960895 GAAAGGGCACAGATGTACTGGGG - Exonic
1015696420 6:135985225-135985247 ATAAGGAAACAGCTATATGGAGG - Intronic
1016329560 6:142943511-142943533 CAAAAGAAACAACTGTATTGAGG + Intronic
1016357670 6:143235685-143235707 AAAAGGATACCGTTGTATTTAGG + Intronic
1016640618 6:146344778-146344800 AAAACGAAAAAGATATACTGTGG - Intronic
1017228139 6:152043534-152043556 ATAAGCAAACAGGGGTATTGAGG + Intronic
1017457340 6:154613653-154613675 ACAAGGAAAAAGATCTAATGTGG - Intergenic
1019956041 7:4415169-4415191 AAAAGAAAACAGCTGGTTTGAGG + Intergenic
1020372643 7:7450712-7450734 AAAAGGAAACAGAATGTTTGTGG + Intronic
1020574217 7:9904718-9904740 AAAAGAATAAAGATGTATTATGG - Intergenic
1020882437 7:13778957-13778979 GATAGGAAAAAGTTGTATTGTGG + Intergenic
1020909886 7:14115734-14115756 AAAAGGAAAGGGGTGTAATGAGG - Intergenic
1021789227 7:24184553-24184575 AAAAGGAAAGACATCTATTATGG + Intergenic
1021822216 7:24509342-24509364 AAAAAAAAACAGCTTTATTGAGG - Intergenic
1022267240 7:28769051-28769073 TAAAGGAAACACATTTATTTGGG + Intronic
1022909907 7:34890941-34890963 AAAAGGAAACTGATGCTTAGAGG - Intergenic
1023006400 7:35873783-35873805 AAAAGGAATCAGAAGTATCAAGG - Intronic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1023201711 7:37705245-37705267 AAGAGCAAACACATGAATTGTGG - Intronic
1023224681 7:37956937-37956959 AGGAGGAAACAGCTTTATTGAGG + Intronic
1023553240 7:41391234-41391256 TAAAAGAAACAGTTATATTGAGG + Intergenic
1023589784 7:41769384-41769406 AAAAAGGAAAAGAAGTATTGGGG - Intergenic
1024958579 7:54951524-54951546 ATAAGCAAACAGATGTATTGGGG + Intergenic
1025246147 7:57319063-57319085 ATAAGGAAACAGATTTAGAGTGG - Intergenic
1026111860 7:67464832-67464854 AAAAGGAAAGAGGTTTATTTTGG - Intergenic
1026674313 7:72416383-72416405 AGAAGAAAACAGCTTTATTGAGG - Intronic
1027376766 7:77558517-77558539 AAAAGGAAACAGATGTGGAGGGG + Intronic
1027479658 7:78680003-78680025 AAAAGCAAATAGTTGCATTGAGG + Intronic
1027669366 7:81076937-81076959 AAAAAGAAACACATGGATTGAGG - Intergenic
1028071927 7:86461038-86461060 AAAAGAAAAAAGAAATATTGTGG + Intergenic
1028163280 7:87509736-87509758 ATTAGGACACAGATGTCTTGTGG - Intronic
1028202424 7:87977014-87977036 AAAAGAAAACAGATTTAGTTGGG + Intronic
1029239115 7:99145977-99145999 AAATGGAAACAGCTGGATTGTGG - Intergenic
1029341407 7:99947735-99947757 AGGAGGAAGCAGATGTGTTGTGG - Intergenic
1029799402 7:102930365-102930387 AAATGGAAACAGGTTTATAGAGG - Intronic
1030368231 7:108670513-108670535 AAAAGCAAACAGGGGTATTGGGG - Intergenic
1030604548 7:111625681-111625703 AAGAGGAAACACATGTATTGTGG + Intergenic
1030900870 7:115121512-115121534 AGAAGAAAACAGCTTTATTGAGG - Intergenic
1030982377 7:116201341-116201363 TACATGAAACAGATGTATTTTGG + Intergenic
1031029300 7:116717041-116717063 TAGTGGAAACAGATGTGTTGAGG + Intronic
1031474756 7:122207784-122207806 AGAAGAAAACAGAGGTGTTGGGG + Intergenic
1032139983 7:129319638-129319660 AAATGCAAACAAATCTATTGTGG - Intronic
1032216760 7:129963334-129963356 AAAAGGAAGAGGATGTACTGGGG - Intergenic
1032617332 7:133488409-133488431 AAAAAGAAAAAGATGAAGTGAGG - Intronic
1032734074 7:134673885-134673907 AAAAGGAAACAGATCCAGAGTGG - Intronic
1032810555 7:135411056-135411078 AAAAGGAGACTGATGAATTTTGG - Intronic
1033087987 7:138359818-138359840 TAAAAGAATCAGACGTATTGAGG + Intergenic
1033475886 7:141691909-141691931 AAAAAAAAACAGATTTATTAAGG + Intronic
1033488589 7:141817201-141817223 AAAAGGAAACCGATGTCCTATGG + Intergenic
1033716251 7:144005657-144005679 AAAAGAAAAGAGAAGTAATGAGG - Intergenic
1033847201 7:145448083-145448105 AGAAGAAAACAGGTGGATTGAGG - Intergenic
1033988828 7:147259282-147259304 AAGAGAAAACAAATGTACTGAGG - Intronic
1034278138 7:149833130-149833152 CAAAGGAAACAGATGAGCTGGGG - Intergenic
1034740867 7:153472175-153472197 AAAAAAAAAAAAATGTATTGGGG + Intergenic
1034864113 7:154625909-154625931 AAAAGGAAAATGTTGTATTCTGG + Intronic
1034965305 7:155387171-155387193 ATGAGGAAACAGATGTGTGGAGG + Intronic
1035170200 7:157013114-157013136 AAAAAGAAACAGATGGGATGGGG - Intergenic
1036714754 8:11110353-11110375 AAAAGGAGCCAGGGGTATTGGGG + Intronic
1037423880 8:18733351-18733373 AAAAGGAAACTGATAAATGGAGG + Intronic
1037609257 8:20462675-20462697 AAAAGGAAACATATTTATTAAGG - Intergenic
1037651726 8:20845103-20845125 AAAATGAAGCAGCTGTTTTGGGG - Intergenic
1038800639 8:30745702-30745724 ACAAGGGAACAGGTGAATTGCGG - Intronic
1039006029 8:33038105-33038127 AAAAACAAACAAATGTATTTCGG + Intergenic
1039085201 8:33772978-33773000 ATAAGGAGACAGATGAATTGAGG - Intergenic
1040798097 8:51309517-51309539 AAAAGTAAACATATATATGGAGG - Intergenic
1041173407 8:55168597-55168619 TAAAGCAAACAGATGAAATGAGG - Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1042219960 8:66463406-66463428 AAAAGGCAGCAGATGCCTTGGGG - Intronic
1043257694 8:78156941-78156963 AAAAGCAAACAGGGGTGTTGTGG - Intergenic
1043800940 8:84608595-84608617 AAAAGGAAACAGGAGTAATATGG - Intronic
1044209187 8:89530175-89530197 GAAAGGATACAGATGAAATGAGG + Intergenic
1044470820 8:92564796-92564818 AAGAAGAAACAAAAGTATTGTGG + Intergenic
1044788331 8:95820256-95820278 AAAAGATAGCAGATGTATTGAGG + Intergenic
1044962798 8:97547302-97547324 AGAAGAAAACAGCTTTATTGAGG - Intergenic
1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG + Intergenic
1045818094 8:106301409-106301431 AAAATAAAAAAGATGTATTTGGG + Intronic
1046024066 8:108700949-108700971 AAAAGGAAATAGATGCATTGAGG + Intronic
1046197248 8:110881805-110881827 AGAAGAAAACAGAGGTGTTGGGG - Intergenic
1047007693 8:120638094-120638116 AAAAGGAACCAGGGATATTGGGG + Intronic
1047174798 8:122530147-122530169 AACAGGAAACAAATGTGCTGTGG + Intergenic
1048108902 8:131444317-131444339 CCTAGGAAAAAGATGTATTGTGG - Intergenic
1050484413 9:6118299-6118321 AAAAGGAAACAGAGGCACAGAGG + Intergenic
1050705922 9:8397274-8397296 AAAAGGGATCATATTTATTGAGG + Intronic
1051187016 9:14470934-14470956 AAAAGGAAACAGAAATGATGAGG + Intergenic
1052107677 9:24539192-24539214 AAAAGGAAAGGGATGTAGTTAGG + Intergenic
1052288780 9:26818847-26818869 AAAACAAAACAGATGTATTCTGG - Intergenic
1052414271 9:28157425-28157447 AAAAGGAAAAAGTGGTTTTGTGG - Intronic
1052441902 9:28508630-28508652 ATAAAGGAAAAGATGTATTGTGG - Intronic
1052450405 9:28622806-28622828 AAAAGGAAACATTTGTATACTGG - Intronic
1053112986 9:35478694-35478716 AAAAGAAAATAGAGTTATTGGGG + Intergenic
1053295275 9:36908384-36908406 AAAAAGAAAGAGAAATATTGTGG - Intronic
1054742769 9:68825515-68825537 AAAGGGAATAAGATGTATGGTGG - Intronic
1054831729 9:69632764-69632786 TAAAGGAAATAGATGTTTTTGGG + Intronic
1054977258 9:71162239-71162261 AAAAGGAAATAGCTGCATTGTGG + Intronic
1054979000 9:71182229-71182251 AATAGGAAAAAGAATTATTGGGG + Intronic
1056242264 9:84659670-84659692 AGAAGAAAACAGCTTTATTGAGG - Intergenic
1056526736 9:87450221-87450243 AAATAAAAGCAGATGTATTGTGG - Intergenic
1056964011 9:91151148-91151170 TGAAGGAAACAGAAGTTTTGTGG - Intergenic
1056976803 9:91264759-91264781 AAAAGCAAAAAGAGGTATTTGGG + Intronic
1058176429 9:101740528-101740550 AAAAGGAAAAAGAAGATTTGGGG - Intergenic
1058348060 9:103988341-103988363 AAAAGGAAACAAAAGTTTTTGGG + Intergenic
1058753412 9:108061823-108061845 TAAAGGTAAGAGATGTACTGGGG + Intergenic
1058855837 9:109061367-109061389 AAATGGAAACAATTGTATTAAGG - Intronic
1059016546 9:110522921-110522943 AAAAGGCAACCTATGTATGGAGG - Intronic
1059678781 9:116566414-116566436 ACAAGTAAACAGATATATTCAGG - Intronic
1060137167 9:121168715-121168737 AAAAGCAAACACCTGTATTCTGG - Intronic
1061308654 9:129748026-129748048 AAAAAAAAAAAGAGGTATTGAGG + Intronic
1062058244 9:134480399-134480421 AAGAAGAAAGAGATATATTGAGG - Intergenic
1186287576 X:8062345-8062367 AACAGGCCACAGATGGATTGAGG - Intergenic
1186322728 X:8447730-8447752 AAAATGACACATATGAATTGAGG + Intergenic
1187094629 X:16134408-16134430 AAATAGAAACAGATTTATAGAGG - Intronic
1187463002 X:19504150-19504172 AAGAGAAAAGAGATGTATTTAGG + Intronic
1187558626 X:20377791-20377813 AAATAGAAACAGGTTTATTGAGG + Intergenic
1187782118 X:22838727-22838749 ATAAGGAAACAGTTTTATAGGGG + Intergenic
1188918742 X:35945503-35945525 CAAAGAAAAAAGAAGTATTGGGG - Intronic
1189141210 X:38608137-38608159 CAAAGGAAACAGATGTTTAAAGG - Intronic
1190367436 X:49709487-49709509 GAAAGGAAACAGTTTTATAGTGG + Intergenic
1190816205 X:53932140-53932162 AAAAAAAAAAAGATGTAATGAGG - Intergenic
1190868470 X:54404930-54404952 CAAAGGAAAGAGAAGTATTAAGG - Intergenic
1191096630 X:56679961-56679983 AGAAGCAAACAGGGGTATTGGGG + Intergenic
1191759047 X:64627463-64627485 AGAAGCAAACAGAGGTTTTGGGG - Intergenic
1192661878 X:73050206-73050228 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1192845431 X:74902485-74902507 AAAAGGTAACAGAAGGATTGGGG + Intronic
1192898602 X:75471007-75471029 AACAGAAAACAGATGGATTTTGG + Intronic
1193246998 X:79240767-79240789 AAAAGGAAACACATACATAGAGG - Intergenic
1193266324 X:79474461-79474483 AAAAGTAAACAGATGAATAAAGG + Intergenic
1193832627 X:86307671-86307693 AGAAGCAAACAGAGGTGTTGGGG - Intronic
1194151819 X:90335119-90335141 CAGAAGCAACAGATGTATTGTGG + Intergenic
1194389973 X:93304883-93304905 GAAAGAAGACAGATGTATTGAGG + Intergenic
1194940862 X:100008465-100008487 AAAAGGAGACAAATTTATTTGGG + Intergenic
1195487913 X:105431386-105431408 AAAATGAAGCAGATGGATAGTGG + Intronic
1196038715 X:111176668-111176690 TAAAGGAATCAGATGTGGTGAGG - Intronic
1196811947 X:119635930-119635952 CACAGGAAACAGAGGTATTCAGG + Intronic
1197001985 X:121450603-121450625 AGAAGCAAACAGAGGTGTTGGGG - Intergenic
1197069021 X:122270905-122270927 CAGAGGAAACAGACGTATTTGGG - Intergenic
1197477677 X:126943775-126943797 AAAAGCAAACAGGGGTGTTGGGG + Intergenic
1197601039 X:128530520-128530542 AAAAAGAAACAGATGTTTGCAGG + Intergenic
1197645714 X:129014437-129014459 AAAGGGAAAGAGATTTATTTAGG + Intergenic
1198105810 X:133460020-133460042 AAAAGAAATCAGTTGTATTAGGG - Intergenic
1198123342 X:133617419-133617441 ACAAGGAAACAGATGCAAAGAGG - Intronic
1198228779 X:134670236-134670258 AGCAGGAAACAGATGCATGGAGG - Intronic
1198447358 X:136730536-136730558 TAAAGAAAACAAATGTCTTGCGG - Intronic
1199025432 X:142931550-142931572 ACAAAGAAACACATGTATTAAGG + Intergenic
1199934453 X:152558652-152558674 TAAAGGAAAGAGATTTATTTTGG + Intergenic
1200498175 Y:3911884-3911906 CAGAAGCAACAGATGTATTGTGG + Intergenic
1201327499 Y:12779541-12779563 CAAAGGAAAGAGATGTATCTGGG - Exonic
1201529931 Y:14980459-14980481 AGAAGCAAACAGAGGTGTTGGGG + Intergenic
1202093490 Y:21218588-21218610 CAAAAGACACAGATGTATTCAGG - Intergenic
1202607662 Y:26652688-26652710 AAAAGGAATCAAATGAAATGCGG + Intergenic