ID: 981131048

View in Genome Browser
Species Human (GRCh38)
Location 4:141158853-141158875
Sequence TTATCTGTGAATAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981131048 Original CRISPR TTATCTGTGAATAAATTGGA AGG (reversed) Intronic
900771567 1:4548867-4548889 TTATTTGGGAAAACATTGGAGGG + Intergenic
904695072 1:32325370-32325392 TTTTCTGTGATTATATTGGTGGG - Intronic
904918529 1:33987608-33987630 TCCTCTGTGGATAAATTGCAAGG + Intronic
905004040 1:34696034-34696056 TTAGCTGTGAAAAAATTAGGAGG - Intergenic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
909224538 1:73001036-73001058 ATATATGTGAATAAATGGTATGG + Intergenic
910172653 1:84394318-84394340 AGATCTGGGAATATATTGGAGGG + Intergenic
911509759 1:98797157-98797179 GTTTCTGGGAATAAATGGGACGG + Intergenic
911746135 1:101443739-101443761 TTATTTAGGAATAAAATGGAAGG + Intergenic
912083179 1:105964263-105964285 TTATGTATCAATAAATTTGAAGG + Intergenic
912086268 1:106009611-106009633 TTCTCTGTGAAGAATTTGGTAGG - Intergenic
913189273 1:116399908-116399930 TTATCTGTCACTCACTTGGATGG + Intronic
913377910 1:118174980-118175002 AGATATGTGAATAGATTGGAAGG + Intronic
914641903 1:149614897-149614919 TCATGTGTAAATAAACTGGATGG - Intergenic
915017034 1:152743912-152743934 TTTACAGTAAATAAATTGGAAGG - Intronic
917622912 1:176816044-176816066 TTATTTAGGAATAAAATGGAAGG + Intronic
922084723 1:222335354-222335376 TTATTTGGAAATAAAATGGAAGG + Intergenic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924571920 1:245244867-245244889 TAATCTCTGAATAAAGTAGAAGG - Intronic
1064796209 10:19014349-19014371 TTTTCTGACAATACATTGGAAGG - Intergenic
1064906670 10:20354404-20354426 TTATATTTGAATAACTTGAAAGG - Intergenic
1067989214 10:51191128-51191150 TTTTCTGTTAATAATCTGGATGG - Intronic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1069373714 10:67772824-67772846 TTATTTGTGAAGTAATTTGAAGG + Intergenic
1070185005 10:74053339-74053361 TTTTATGCTAATAAATTGGAAGG - Intronic
1070634065 10:78109683-78109705 TTATCTGAAAATAAATTTGGAGG + Intergenic
1071209794 10:83326954-83326976 TTTTATGTCAATAAATTAGATGG - Intergenic
1071687997 10:87782543-87782565 TTCTCTGTGAATTATTTGGAAGG + Intronic
1073531602 10:104237659-104237681 TTATGTGGGAATAAAATGGGAGG + Intronic
1073829619 10:107367331-107367353 TTCCCTGTGAATAAATCAGATGG + Intergenic
1073844700 10:107541796-107541818 TCACCTGTGAATAAATGGGATGG + Intergenic
1074003202 10:109392987-109393009 TTATCTGTGAATGACTTGGTTGG - Intergenic
1078076010 11:8161489-8161511 TTATCAATGGATAGATTGGAGGG - Intronic
1079243057 11:18734309-18734331 TGACATGTGAATAAATTGAAAGG - Intronic
1079513754 11:21242028-21242050 TTGTCTGTGAATAGATATGATGG + Intronic
1081393227 11:42554577-42554599 TTATCTTTTAATAAACTGTATGG - Intergenic
1086367588 11:86123502-86123524 TAATCTGTGAAAACTTTGGAAGG - Intergenic
1086603588 11:88666012-88666034 TTATCAGTGAATATCTGGGAGGG + Intronic
1087386781 11:97482040-97482062 TCATCTATGAATGTATTGGAAGG + Intergenic
1087565451 11:99850994-99851016 TAATCAGTGAATAAAGTGAATGG - Intronic
1088057103 11:105597372-105597394 TCTTCTGCGAATAAAATGGAAGG + Intergenic
1088390359 11:109307461-109307483 AAATCTGTGTGTAAATTGGATGG + Intergenic
1089821617 11:121233037-121233059 TTAATTTTGAATAAATTGGTAGG - Intergenic
1090144142 11:124301193-124301215 TTTTCTGTGAACAAATTTTAAGG + Intergenic
1090169217 11:124584013-124584035 TTATCTGTGATTAACTTTTATGG + Intergenic
1090296110 11:125590138-125590160 TTATTTGTGAATAAAATCAAAGG - Intergenic
1090442109 11:126732929-126732951 GTATCTGTGAATACAATGGGAGG - Intronic
1090624043 11:128590129-128590151 TTATCTGTGGATAAATAGTTGGG - Intergenic
1093044418 12:14426409-14426431 TTTTCTTTGAAGAAATTAGATGG - Intronic
1093125233 12:15321361-15321383 TTATCTGTGAATAATTTTACTGG - Intronic
1093220938 12:16419714-16419736 TTATCTAAGAATAGCTTGGAAGG + Intronic
1093414497 12:18904571-18904593 TTGTCTCTAAATAAATTGAATGG - Intergenic
1093422545 12:18991704-18991726 TTTTCTCTGAATAACCTGGACGG + Intergenic
1094178602 12:27567209-27567231 TCTTCAGTGAATAACTTGGAAGG + Intronic
1097488074 12:60231288-60231310 ATATCTGTGAAGAAATTAAAGGG + Intergenic
1097497600 12:60360557-60360579 TTATAAGTGAAATAATTGGAAGG + Intergenic
1098437257 12:70481269-70481291 TTATTTGTAGATAAATTGAAGGG + Intergenic
1098824592 12:75279191-75279213 TCATGTGTAAATAAATTGGCTGG - Intronic
1099930924 12:89073591-89073613 TAATCTGTGATTAGAGTGGAAGG - Intergenic
1100182859 12:92104406-92104428 TTATTTGTGTATAAACTGTAAGG - Intronic
1100921228 12:99489838-99489860 TTATTTGGTAATAAATTGAATGG + Intronic
1103625533 12:122215984-122216006 TTATATGTGAAGAAACTAGAGGG - Intronic
1104222860 12:126802424-126802446 TTATCTGTAAACAAATGGGGAGG + Intergenic
1108724759 13:53167870-53167892 TTATTTGTGAGCAAATGGGAGGG - Intergenic
1109088423 13:58007044-58007066 TTATTTTTGAATAAATTAAAAGG + Intergenic
1109314853 13:60738431-60738453 TTATCCTTGAAGAAAATGGAGGG - Intergenic
1109518346 13:63474264-63474286 TTATCTGTCAATATATGTGAGGG - Intergenic
1109603340 13:64661219-64661241 TTGTCTCTGAATAGATTGAAAGG + Intergenic
1109965367 13:69685443-69685465 TCATCTGTGAATACATTGATAGG - Intergenic
1110112457 13:71765290-71765312 TAATCTGTGACTAAATTCCATGG + Intronic
1110971076 13:81761769-81761791 TTATCAGTCAATAAATTGAGTGG - Intergenic
1111458201 13:88510388-88510410 TTGTCTGTGAATAAAAAAGAGGG + Intergenic
1111585338 13:90276743-90276765 TTATCTGTGAATACATTGACTGG - Intergenic
1112138871 13:96615561-96615583 ATATCTGAAAATAAGTTGGAAGG + Intronic
1112884615 13:104153748-104153770 ATATATGTTAATAAATTGGTAGG - Intergenic
1114190915 14:20438797-20438819 ATATCTGTTAATGAATTGTATGG + Intergenic
1116864281 14:50018731-50018753 TTATTTTTGTTTAAATTGGATGG - Intergenic
1117571705 14:57055495-57055517 TTCACTGTGAATGAATTGGTTGG - Intergenic
1117819056 14:59629798-59629820 GTATCTGTGAAATAAATGGAGGG - Intronic
1118731933 14:68673213-68673235 TGATCTGAAAATAACTTGGAAGG + Intronic
1120769765 14:88366228-88366250 TTATTTAGGAATAAATTGGGAGG + Intergenic
1121181087 14:91929449-91929471 TTATCTGTGAAAAGAAAGGATGG - Intronic
1122166445 14:99827955-99827977 TTGCCTGTGAATGAAATGGAGGG + Intronic
1122594064 14:102877014-102877036 TTATCTATGAATTGAGTGGAAGG - Intronic
1202882192 14_KI270722v1_random:71008-71030 CTATCTCTGAATAAATTGCTGGG + Intergenic
1123508841 15:20974291-20974313 TTATTTGACAATAAATTGGAAGG - Intergenic
1123566065 15:21548040-21548062 TTATTTGACAATAAATTGGAAGG - Intergenic
1123602323 15:21985327-21985349 TTATTTGACAATAAATTGGAAGG - Intergenic
1125278068 15:38014444-38014466 TTATTTTTGAAGAAATTAGAAGG - Intergenic
1125671839 15:41479328-41479350 ATATCTGTAAATAACTGGGATGG - Intronic
1126218896 15:46189342-46189364 CTATCTGAGATTAAACTGGATGG + Intergenic
1130216380 15:81974256-81974278 ATATCTGAGCATAAAATGGAAGG + Intergenic
1130875714 15:88012328-88012350 TTATTTGTGAATAATAAGGAAGG - Intronic
1131708021 15:95019761-95019783 TTATATCTCAATAAAATGGAAGG - Intergenic
1202974428 15_KI270727v1_random:275134-275156 TTATTTGACAATAAATTGGAAGG - Intergenic
1140520570 16:75577489-75577511 TTATTTCTTAATATATTGGAAGG + Exonic
1141011922 16:80409500-80409522 TTCTCTGTGCATCATTTGGATGG - Intergenic
1143721680 17:8816034-8816056 TTATCTGTGAGGAAACTGGGTGG - Intronic
1146847412 17:36191770-36191792 TTCTCAGTCAATAAGTTGGAAGG - Intronic
1149027357 17:52043198-52043220 TTCTGTGTTAATGAATTGGAAGG - Intronic
1149941923 17:60879325-60879347 TTATATGTGAATACAATGAAGGG + Intronic
1150013940 17:61534299-61534321 TTATCTGTGAATAACTTTGGGGG - Intergenic
1150870641 17:68906574-68906596 TTTTTTGAGAATTAATTGGATGG + Intronic
1153291146 18:3503040-3503062 TGTTCTCTGAATAAATTGTATGG - Intronic
1153417721 18:4867574-4867596 TTATTTGTGAATGGGTTGGATGG - Intergenic
1153456492 18:5288156-5288178 TTATCTGTAAGTCATTTGGAAGG - Intergenic
1154047366 18:10919014-10919036 ATATATTTGAATAAATTTGAGGG - Intronic
1154173945 18:12070078-12070100 ATATATTTGAATAAATTTGAGGG + Intergenic
1155569725 18:27179362-27179384 GTATCAGTGAACAAATGGGATGG + Intronic
1155818448 18:30345827-30345849 TTAAATGTGAAGAAATTGGAGGG - Intergenic
1156365319 18:36420746-36420768 TTATCTGTGATTCACTTAGATGG + Intronic
1157371460 18:47116574-47116596 ATATTAGTGAATAAATTTGAAGG - Intronic
1159610262 18:70517088-70517110 TTACATGTGAATAATTTGGATGG + Intergenic
1160302926 18:77702648-77702670 TTATCTGAGAATAAATTTAAAGG - Intergenic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
925043460 2:752253-752275 TTATATGTTAATAAATTGTTAGG - Intergenic
925504705 2:4548853-4548875 TTATATGTCAATAAATTGCCGGG - Intergenic
928319892 2:30274618-30274640 TGATCTCTGAATAAACTGAAAGG - Intronic
928561571 2:32493754-32493776 TTATCTGTGAACAAATAAGCAGG + Intronic
929775844 2:44930023-44930045 TTATCTGTGAATAATTGAGAAGG - Intergenic
930206408 2:48591001-48591023 TTATCTGTAAATAGATGGTAAGG + Intronic
930228509 2:48819511-48819533 TTATTGGTGAGTAAATTAGATGG + Intergenic
930560677 2:52956573-52956595 TTATAAGTGAATAAGATGGAAGG + Intergenic
932085459 2:68753785-68753807 TTATCTGTGGAAACATTTGAAGG + Intronic
932727626 2:74193214-74193236 TTATTGGGGAATAAATTGGAAGG + Intergenic
933099481 2:78234442-78234464 TTTGCTGTGAATAAATCTGAAGG - Intergenic
933453804 2:82495882-82495904 TTCTCTGTGAAAAAATTGTCTGG - Intergenic
933610733 2:84431956-84431978 TTATCTGGGAATAATTTTGTGGG - Intronic
933948886 2:87311421-87311443 TTCTCTGTAAAAGAATTGGAAGG + Intergenic
935578509 2:104735423-104735445 TTATCTGTGATTGATTGGGATGG + Intergenic
936331313 2:111550175-111550197 TTCTCTGTAAAAGAATTGGAAGG - Intergenic
937011189 2:118564201-118564223 TTATTTGGGAATAAAATGGGAGG - Intergenic
937786719 2:125907621-125907643 TTATTTGTGACTAAATATGAAGG - Intergenic
939594049 2:144103061-144103083 TTATAGGGGAATATATTGGATGG + Intronic
939615027 2:144352934-144352956 TTATCTGTCAATAAAATGAGAGG - Intergenic
939639298 2:144619669-144619691 TTATTTTTGAATAAATAGAAGGG + Intergenic
940117378 2:150223946-150223968 TTATTTGTGAATAAATGGTGAGG - Intergenic
940585406 2:155642212-155642234 TTATCTGTAAATAAATTAAGCGG + Intergenic
940696243 2:156983061-156983083 CTATCTGTGTATACACTGGATGG + Intergenic
940792182 2:158040784-158040806 TTATTTGTAAATAAATTTGGTGG + Intronic
940928686 2:159399189-159399211 TTTTCTGTGATTAAATTTTAAGG - Intronic
942388811 2:175470528-175470550 TTATCATTGAGTAAAATGGATGG + Intergenic
942789716 2:179746536-179746558 TTATCTTAGAATAAAATTGATGG - Intronic
942805102 2:179921663-179921685 TTATCTGTAAATAAAAGAGAAGG - Intergenic
943125135 2:183787307-183787329 TTATCTTTGAAGAAAAGGGAAGG - Intergenic
943989041 2:194661875-194661897 TTGTCTTTCAATAAATTGAAGGG + Intergenic
947002471 2:225472723-225472745 TTATCTAGAAAGAAATTGGATGG + Intronic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
1172450544 20:35019637-35019659 TTATATGTGAAATAATTGTAGGG - Intronic
1175059100 20:56225515-56225537 GTATCAGTGAACAAATTAGATGG + Intergenic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1176597696 21:8762448-8762470 CTATCTCTGAATAAATTGCTGGG + Intergenic
1177551093 21:22623676-22623698 TTATCAGTGGTTAAATTGTATGG - Intergenic
1180249591 21:46573239-46573261 TTATCTGTAAATAGATTAAATGG + Intergenic
1180420743 22:12812348-12812370 CTATCTCTGAATAAATTGCTGGG - Intergenic
1182564614 22:31188299-31188321 TTATTGGTGAATAAATAGAATGG + Intronic
1185036127 22:48477872-48477894 TGTTGTGTGAATAAATTGTAGGG - Intergenic
949307360 3:2657885-2657907 TTATCTGTCAATGATATGGAAGG - Intronic
949681941 3:6524137-6524159 TTAAATGTGAAGAAATTGAATGG - Intergenic
951868303 3:27332373-27332395 ATTTTTGTGAATATATTGGAAGG + Intronic
952276693 3:31883971-31883993 TTCTCTGTGGATAAGTTGGTAGG - Intronic
956287372 3:67625269-67625291 TCACCTGTGAATAAATGGCAGGG - Intronic
956962108 3:74415212-74415234 GGATCTGGGAATAAACTGGAAGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
958190723 3:90180687-90180709 TTATTTGGGAATAGATTGCATGG - Intergenic
958412911 3:93839865-93839887 TTATTTGGGAATAGATTGCATGG - Intergenic
959059900 3:101606559-101606581 TTAAATGTGAATAGATTGGCTGG - Intergenic
960019153 3:112930342-112930364 GTATGTGTGACTAAATAGGAAGG - Intronic
960312843 3:116137528-116137550 TTATATGTAAATCCATTGGAAGG - Intronic
961320120 3:126067208-126067230 ACATCTCTGAATAAATTGGTAGG - Intronic
961515411 3:127429849-127429871 TTAGCTCTGAATGAATAGGAGGG - Intergenic
961973632 3:130997345-130997367 TTACATGTAAATGAATTGGATGG + Intronic
962115326 3:132499869-132499891 ATATCTGAGAATCAACTGGAGGG + Intronic
963225192 3:142855180-142855202 TAATCTGTGAAGAAATAAGAGGG - Intronic
964140998 3:153399122-153399144 TTAGCTGTGGAGAAATTTGAGGG - Intergenic
964296994 3:155244647-155244669 TTATCTCTAAATAAAATGGAAGG + Intergenic
964363228 3:155920611-155920633 TGATCTGTGAATGTAATGGAGGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965612286 3:170557168-170557190 TTATTTTTGGATAAATTGGTTGG + Intronic
966126839 3:176587654-176587676 TTATCTGTGGAAATATTGTAGGG - Intergenic
966149091 3:176846850-176846872 TTATCTGTGGACAACTTGAAAGG + Intergenic
967442842 3:189528708-189528730 TTATTTGAGAAAAAATTGTAGGG + Intergenic
970291596 4:14578822-14578844 TTATCTGGGATTGAAATGGAAGG + Intergenic
970656666 4:18238271-18238293 GCATCTGTGAACAACTTGGAAGG - Intergenic
970670424 4:18390503-18390525 ATATGTGTAAATAAATTGAAAGG - Intergenic
971594561 4:28512318-28512340 TTATATGTGAAAATATTGAAAGG + Intergenic
972766270 4:42154273-42154295 TTATCTGGGAGTAAAGTGGGAGG - Intergenic
973125267 4:46575388-46575410 TTATCTGTGTATCAATAGGCAGG + Intergenic
973360999 4:49164702-49164724 CTATCTCTGAATAAATTGCTGGG + Intergenic
974492927 4:62589893-62589915 TTATTTAGGAATAAAATGGAAGG + Intergenic
975010000 4:69339218-69339240 TTATGTCTCAAAAAATTGGAAGG - Intronic
975039651 4:69729763-69729785 ATATCTTTGATTGAATTGGAGGG - Intronic
975423290 4:74195337-74195359 TGTTTTGTGAATAAATTGTATGG + Intronic
978741598 4:112144255-112144277 TTTTCCTTGAATAAAATGGATGG + Intergenic
978818292 4:112934146-112934168 TTATGAGAGAATAAATTAGAAGG + Intronic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
979701643 4:123675017-123675039 TAATTTGTGAGTAAATTTGAAGG - Intergenic
980029795 4:127814157-127814179 TCACCTGTGAATAAAGTGCATGG + Intronic
980305226 4:131052378-131052400 TTGTATGTGACAAAATTGGAAGG + Intergenic
980439640 4:132824082-132824104 TTCTATGTGAACAAATTGGCAGG - Intergenic
980776288 4:137440680-137440702 TTATCTTTGGATAAATTTCAAGG - Intergenic
980927666 4:139154537-139154559 TTATTTGGGAATAAAATGGGAGG - Intronic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
981669269 4:147268123-147268145 TCATCAGTGAATAAATGGGTAGG - Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
984036184 4:174670911-174670933 TTATCAGTAATAAAATTGGATGG + Intronic
984516414 4:180746905-180746927 TTAGAGGTGAATAAATGGGACGG + Intergenic
985842131 5:2315086-2315108 TTATTTGTGTATAAATTGTAAGG + Intergenic
988951230 5:36263251-36263273 TTATTTTTGAATAAATTATAAGG - Intronic
989550240 5:42726468-42726490 TTATCTGGGATTAGATTTGAGGG - Intergenic
990122580 5:52473217-52473239 TTATCTATTAATAAAATGGTGGG - Intergenic
993232546 5:85255247-85255269 CTATCTGTGAAAAAAATGGTGGG + Intergenic
993616085 5:90114194-90114216 TTATCCAGGAATAAATGGGATGG + Intergenic
994364299 5:98894683-98894705 TTATCTATTAAGAAATTTGAAGG + Exonic
994470865 5:100204260-100204282 TTATATGTGAAGAAATAGAAGGG + Intergenic
994786470 5:104171258-104171280 TTAGCTATGAATAAAATGCATGG + Intergenic
996187546 5:120496955-120496977 TTACCTGTGAATTATTTGAAAGG + Intronic
996291796 5:121860248-121860270 TTATCTGTGAAAAAGTTCCAAGG + Intergenic
996467395 5:123819615-123819637 TTATATGTGAATACATTCCAGGG + Intergenic
998889973 5:146735552-146735574 TTTTATATGATTAAATTGGATGG + Intronic
999215865 5:149934594-149934616 ATGGCTGTGAATAAAGTGGATGG - Exonic
1000401763 5:160836229-160836251 TTTTCTGTGTGTAAATTGAAGGG - Intronic
1001685066 5:173587483-173587505 TTTTCTGTGAAGAAATTTTAGGG - Intergenic
1001949285 5:175804967-175804989 TTACATGTGAACAAAATGGAGGG - Intronic
1003064720 6:2894263-2894285 ATTTCTGTGAATAAATGAGACGG - Intronic
1007884431 6:45210202-45210224 TTATTTAGGAATAAAATGGATGG - Intronic
1008334714 6:50288380-50288402 TTATCTGTAAATATATGAGATGG - Intergenic
1012098758 6:95001928-95001950 TTATCTGTATATAAGTTGGTTGG + Intergenic
1012148146 6:95712064-95712086 TTATCCTTAAATAAATGGGAAGG - Intergenic
1014125681 6:117774563-117774585 TTATCTGTGAAAAAATTAACAGG - Intergenic
1014359212 6:120454879-120454901 TTATCTGTGAATAAATTAAATGG - Intergenic
1015444972 6:133293194-133293216 TTATCTGGGCATACATTGGATGG - Intronic
1015506039 6:133989629-133989651 TTATCTGTATAAAAATTGGCAGG - Exonic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016212334 6:141553263-141553285 TTATCTGTGTATAAATAGATAGG + Intergenic
1017058793 6:150461386-150461408 TTATCTTTGAAGCAATTGTATGG - Intergenic
1017752986 6:157505844-157505866 TTTTCAGTGAATGATTTGGAAGG + Intronic
1020571298 7:9866250-9866272 ATATCAGTGAATATATTTGAGGG - Intergenic
1021853952 7:24834932-24834954 TTCCCTGTGAATAAAGTCGATGG - Intronic
1022023641 7:26425763-26425785 TTATCTTTCTATAAAATGGAGGG - Intergenic
1022438279 7:30410847-30410869 TTATTTGTGAAACAAATGGATGG + Intronic
1024428523 7:49259091-49259113 TTATTTGTGCATATATTTGAGGG - Intergenic
1026177979 7:68014498-68014520 TTGTCTTTGAATAAATTCGAGGG + Intergenic
1027510444 7:79072427-79072449 TTAACTGAAAATAAATTGAAGGG - Intronic
1027623521 7:80521396-80521418 ATAGCTGTGAATGAATTGGCTGG - Intronic
1027697353 7:81428570-81428592 TCATCTGTGAACAAAGAGGAGGG + Intergenic
1027994080 7:85401613-85401635 TTTTCTGTAGATAAATTGGCTGG + Intergenic
1030424756 7:109360948-109360970 TTATGTGTGAAGAAAATGGCAGG + Intergenic
1030730520 7:112982661-112982683 TTATCAGTGTAAAAACTGGAGGG - Intergenic
1031235695 7:119173400-119173422 TTATCTGTGAAAAAAGTTTATGG + Intergenic
1031299378 7:120044348-120044370 TTATATGTGAGTAATTTTGAAGG - Intergenic
1031473606 7:122196374-122196396 TTATCAAGGAATAAATTGCAAGG + Intergenic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1033940881 7:146651751-146651773 TCATCTGGGCATAAATTGCAAGG + Intronic
1034059646 7:148075051-148075073 TTAGCTATGAAAAAATGGGAAGG - Intronic
1034217029 7:149415631-149415653 TTATCTGCGATGAAAATGGAGGG + Intergenic
1034823346 7:154237284-154237306 TTATCTGGAAATAAAATGAAGGG + Intronic
1035292851 7:157850661-157850683 TTGTCTGTCAAGGAATTGGAGGG - Intronic
1035861694 8:3035721-3035743 TTATAAGTGAATAAATTGCCAGG + Intronic
1036218617 8:6901914-6901936 TTATCTAGGAATAAAATGGGAGG + Intergenic
1036427180 8:8655351-8655373 TTAACTGTGTATAAATTAGATGG + Intergenic
1039177511 8:34826117-34826139 TTTTCTGTGAAGAGATTGAAAGG + Intergenic
1039192567 8:34993722-34993744 CTATCTGTGAAGCTATTGGAGGG + Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040039271 8:42899376-42899398 TTATCAGTGACAAAATTGGAGGG + Intronic
1040700562 8:50058778-50058800 TTACCTGTGATAAAATTGCATGG - Intronic
1040909648 8:52505005-52505027 TTATCTGTAAATAAAAAGGAAGG - Intergenic
1041578761 8:59432202-59432224 ATATCAGAGAATAGATTGGAAGG + Intergenic
1041958792 8:63587258-63587280 TTTTCTCTGAATGAGTTGGAAGG + Intergenic
1042012318 8:64261110-64261132 TTATCTGTTAAAAAACTGAATGG - Intergenic
1043548964 8:81347195-81347217 TTATCTATAAATACATTGGTAGG + Intergenic
1043790492 8:84461248-84461270 TGATCTTTGATTAAAATGGAAGG - Intronic
1044231079 8:89778821-89778843 TTATCTGTGAATAGAATTGCTGG + Intronic
1044617697 8:94159068-94159090 TTAACTGTAAGTACATTGGACGG + Intronic
1044939299 8:97324348-97324370 TTATATGTCAATAAAATTGAGGG - Intergenic
1045806543 8:106168918-106168940 TTATTTGAGAATGAATTGCATGG - Intergenic
1046817754 8:118603838-118603860 TAATATATGAATATATTGGAAGG + Intronic
1047816742 8:128473001-128473023 ATATCAATGAATAAATTGAAAGG - Intergenic
1050015630 9:1230469-1230491 AAATCTATGAATAAATTTGAAGG - Intergenic
1050184518 9:2958729-2958751 CTAGTAGTGAATAAATTGGAGGG + Intergenic
1050244406 9:3672867-3672889 TTGGCTGTGATTAAAATGGAGGG + Intergenic
1050518822 9:6475564-6475586 TGGTCAGTGAATAACTTGGAAGG + Intronic
1050710198 9:8453062-8453084 TTATTTGTGTATAAAATAGAGGG + Intronic
1050921384 9:11205400-11205422 TAATCTATGATTAAATTAGATGG + Intergenic
1051049239 9:12911837-12911859 TTATCTGTTAAAAAATTACATGG - Intergenic
1051671317 9:19513609-19513631 TAAGCTGGGAATAAATGGGAGGG + Exonic
1051962465 9:22784497-22784519 AGATATGTGAATAAAATGGAAGG - Intergenic
1052092236 9:24342903-24342925 TTATCTAAAAATAAATTGAAAGG + Intergenic
1052397143 9:27952520-27952542 TTATGTGTGAATGCATTGTATGG - Intronic
1053037506 9:34837912-34837934 TTATCTGGGAATCAGATGGAAGG - Intergenic
1055015250 9:71609799-71609821 TTATATGTGAATGAAATGAATGG - Intergenic
1055102781 9:72482340-72482362 CTGTCTGTGAATGAATTAGAAGG - Intergenic
1056788163 9:89607148-89607170 AGATCTGAGAAAAAATTGGAAGG + Intergenic
1057861929 9:98647530-98647552 TTATCTGTGAATAACAGGGGCGG + Intronic
1057912442 9:99030513-99030535 TTATCTGTGAGTCAATGGAATGG + Intronic
1058052521 9:100421171-100421193 TTATATGTAAATCAATTTGATGG - Intergenic
1058197890 9:102001261-102001283 TTATCAGTGAATGAAATGGCTGG - Intergenic
1058792262 9:108460777-108460799 TTATATGCCAATAAATTAGATGG + Intergenic
1059186103 9:112272570-112272592 CTATCTGTTAAAAAAATGGATGG - Intronic
1059612597 9:115915377-115915399 TTATCAGTGAACAAAGTAGATGG - Intergenic
1060165283 9:121408619-121408641 TTATTTGGGAATAAAATGGGAGG - Intergenic
1203555595 Un_KI270743v1:204871-204893 CTATCTCTGAATAAATTGCTGGG - Intergenic
1185788735 X:2912286-2912308 TTATCTGAGAATCAATAGAAGGG - Intronic
1185942993 X:4342006-4342028 TTTTCTCTGAATACATTGAAGGG - Intergenic
1186139586 X:6557031-6557053 TTATCTGTGAATTACATGTAAGG - Intergenic
1186357872 X:8806468-8806490 TTATCTGAGATTAGTTTGGAAGG + Intergenic
1186617620 X:11205685-11205707 TTATCTGAGATTAGTTTGGAAGG - Intronic
1189439356 X:41020498-41020520 TTTTCAATGAATAAATTGCAAGG - Intergenic
1191666367 X:63706653-63706675 CTATCTGTAAATAGAGTGGAGGG + Intronic
1192430161 X:71106423-71106445 TTATCTGAGAAGAGATAGGATGG + Exonic
1192939467 X:75898173-75898195 TTATCTTTGACAAAATTGCAAGG - Intergenic
1193847022 X:86484998-86485020 CTATCTAAGAATAAAGTGGACGG - Intronic
1194499456 X:94661964-94661986 TTATCTGTGCATAACTTGTCAGG + Intergenic
1194976135 X:100398033-100398055 GTATATGTGAATGAATTAGAGGG - Intronic
1196062829 X:111429936-111429958 TCATCTTTGTATAAATTGCAAGG - Intergenic
1196266001 X:113647189-113647211 TTATTTAGGAATAAAATGGAAGG + Intergenic
1196596622 X:117553165-117553187 TTATTTTTAAATAAAATGGATGG + Intergenic
1197240557 X:124118656-124118678 TTATCTGTGAAAAATTTGTTTGG - Intronic
1198001455 X:132442710-132442732 CTATCTCTGAATAAAATGCATGG - Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198325286 X:135565186-135565208 TTTTCAGGGAATAATTTGGAAGG - Intronic
1198689802 X:139268449-139268471 TCCTCTGTGAAAAAATGGGAAGG + Intergenic
1199135645 X:144248102-144248124 TTATATTTGAAAAAATTGAAAGG + Intergenic
1199279477 X:145983207-145983229 TTTTTTTAGAATAAATTGGAAGG + Intergenic
1199757467 X:150878663-150878685 GTATATGTGAATAAAATGCATGG + Intronic
1201286198 Y:12380835-12380857 TTATCTGAGAATCAATAGAAGGG + Intergenic