ID: 981134097

View in Genome Browser
Species Human (GRCh38)
Location 4:141190431-141190453
Sequence CAGTTCCTAGGGATGTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981134097_981134105 14 Left 981134097 4:141190431-141190453 CCTGAGGACATCCCTAGGAACTG 0: 1
1: 0
2: 1
3: 11
4: 130
Right 981134105 4:141190468-141190490 CAACAGTCACCCAGAAAATTGGG No data
981134097_981134104 13 Left 981134097 4:141190431-141190453 CCTGAGGACATCCCTAGGAACTG 0: 1
1: 0
2: 1
3: 11
4: 130
Right 981134104 4:141190467-141190489 CCAACAGTCACCCAGAAAATTGG 0: 1
1: 0
2: 3
3: 17
4: 202
981134097_981134100 -10 Left 981134097 4:141190431-141190453 CCTGAGGACATCCCTAGGAACTG 0: 1
1: 0
2: 1
3: 11
4: 130
Right 981134100 4:141190444-141190466 CTAGGAACTGAGATCAACCCTGG 0: 1
1: 0
2: 2
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981134097 Original CRISPR CAGTTCCTAGGGATGTCCTC AGG (reversed) Intronic
900663069 1:3795762-3795784 CAGTTCCTAGTGACGCCCCCTGG - Intronic
901883935 1:12209620-12209642 CTGGGCCCAGGGATGTCCTCTGG - Intergenic
903247990 1:22030564-22030586 CTGGCCCCAGGGATGTCCTCAGG + Intergenic
907557575 1:55358102-55358124 CATTTCCTAGGGATGCTGTCAGG + Intergenic
910243366 1:85112440-85112462 CTATTCCTAGGGATGTACCCAGG - Intronic
910936518 1:92487053-92487075 CAGTGCCTGGGTATGACCTCAGG - Intergenic
915794525 1:158714944-158714966 CAGTTCCTAAAGGTGTCCACTGG + Intergenic
917478185 1:175386691-175386713 CATTTCCTAGGTCTTTCCTCAGG - Intronic
920508268 1:206532331-206532353 CAGTTCCTAGGGCTGCCATGAGG - Intronic
923971250 1:239205418-239205440 CAGTTTCTAGGGAGGGTCTCAGG - Intergenic
924044019 1:240009915-240009937 GACTCCCTAGGGATGTCATCAGG + Intergenic
1065146913 10:22778967-22778989 CAGACCCTAGGGATTGCCTCTGG + Intergenic
1066801985 10:39202865-39202887 CAGTTCCCAGGAATTTGCTCAGG - Intergenic
1072989176 10:100174178-100174200 CTTTTCCTAGGGAAGTTCTCTGG - Intronic
1073144871 10:101273937-101273959 CATTTCCCAGCTATGTCCTCAGG - Intergenic
1075717798 10:124566970-124566992 CAGTGCCTGGAGATGTCATCTGG - Intronic
1079835222 11:25325699-25325721 CTGTTCCTAGGGCTGGTCTCAGG + Intergenic
1082739356 11:56893302-56893324 CATTTACTAGGAATGTCCTGAGG + Intergenic
1083214449 11:61209726-61209748 CACTTTCTAGGGCTGTCCTGCGG - Intronic
1083217333 11:61228555-61228577 CACTTTCTAGGGCTGTCCTGCGG - Intronic
1085903067 11:80725302-80725324 CAGTTCCTAGGTATTTACTCAGG - Intergenic
1089284365 11:117396159-117396181 CTGTTCCAAGGGATTTCCTCAGG - Exonic
1089598600 11:119598741-119598763 TATTTCATAGGGTTGTCCTCAGG - Intergenic
1094160244 12:27382511-27382533 CTGTTCCAAGGAATCTCCTCTGG - Intronic
1099786317 12:87268739-87268761 CTGCTCCTAAGGATGCCCTCAGG + Intergenic
1103446131 12:120996477-120996499 CAGTCCCTAGGGAGGCCCTGTGG + Intronic
1104610610 12:130224823-130224845 CAGTTCCTACGAATGTCCGGAGG + Intergenic
1104704089 12:130930097-130930119 AACTTCCTAGGGTTGTCCTAAGG + Intergenic
1109058526 13:57582600-57582622 CAGGTCCTAGGAAAGTACTCAGG + Intergenic
1112213547 13:97405844-97405866 TAATTCCTAGGTATGTCATCTGG - Intergenic
1112334315 13:98501405-98501427 CAGTTCCTGGGGCTCTCTTCTGG - Intronic
1112964408 13:105169450-105169472 CCTTTCCTAGGGATTTCCTCTGG - Intergenic
1117339391 14:54780756-54780778 CAGTGCCTGTGGAGGTCCTCTGG - Intronic
1119194085 14:72704095-72704117 CACTTCCTAGCCATGACCTCAGG - Intronic
1119585789 14:75833591-75833613 TACTTCCTAGGGATGTTCTCAGG + Intronic
1120426101 14:84350530-84350552 CAATTCCTAGGCAAGTCCTGTGG + Intergenic
1120991674 14:90383023-90383045 CAGGTCCTAGGGATGTGGTGGGG - Intergenic
1121424909 14:93843460-93843482 CCCTTCCCAGGGCTGTCCTCAGG - Intergenic
1124250611 15:28104538-28104560 CAGTGACAAGGAATGTCCTCAGG + Intergenic
1125598388 15:40902002-40902024 CAGTTCCTAGGCCTGAACTCAGG + Intronic
1126840331 15:52711396-52711418 CAAATTCTAGGGATGTCCTAGGG + Intergenic
1128108012 15:65058601-65058623 CAGTTCCTGGGGGTGTCCTGGGG + Exonic
1128316646 15:66663699-66663721 CAGTTCCTAGGTATTTACCCAGG - Intronic
1129887476 15:79048774-79048796 CAGTTTCTAGGGATGGCGTTGGG + Intronic
1131158964 15:90091966-90091988 CAGTTCCCAGGCATGAGCTCAGG - Intronic
1131337175 15:91560526-91560548 CAATTCCTGGGGATGGACTCAGG + Intergenic
1137351710 16:47719067-47719089 CAGTTCCTGTGGATGTGCTGGGG + Intergenic
1137747612 16:50834710-50834732 CTGATCCTAGGGGTGGCCTCAGG - Intergenic
1139344752 16:66295821-66295843 CCCTTCCTTGGGATGTCCTTGGG - Intergenic
1142174902 16:88640653-88640675 CTGTTCCCAGGGGTGTCCTCAGG - Intergenic
1142483038 17:230096-230118 CCGTGCCTGGGGCTGTCCTCGGG - Intronic
1143036674 17:4003636-4003658 CAGGTCCTAGAGATCGCCTCGGG + Intergenic
1143325155 17:6093740-6093762 TAGTTCCTAGGGTTGTCATGAGG - Intronic
1143572440 17:7768113-7768135 CTGTTCCCAGGGAGGTCGTCGGG + Intronic
1148985455 17:51617022-51617044 CAGTTCCTTGGGGTGTATTCTGG + Intergenic
1149748980 17:59127306-59127328 CAATTCCTAGGTTTATCCTCTGG - Intronic
1151990357 17:77570568-77570590 CAGTGCCTAGTGATGCCCTTGGG + Intergenic
1154390737 18:13934191-13934213 CAGTTCCTGGGGGTGAGCTCAGG + Intergenic
1155064887 18:22259930-22259952 CACTTCCTCAGGATGTACTCTGG + Intergenic
1161495332 19:4583344-4583366 CAGTTCCTGGGCATGTTCCCAGG + Intergenic
1164737831 19:30554836-30554858 CATTCCCTAGGGATGACCACGGG - Intronic
926766557 2:16327386-16327408 GGGTTCCTGGAGATGTCCTCAGG + Intergenic
929800102 2:45092563-45092585 CAGTTTCTGGGGTTGTCCTTGGG + Intergenic
931784559 2:65607730-65607752 CAATTCCTGGGGGTGACCTCAGG + Intergenic
932668422 2:73716640-73716662 CTGCTCCCAGAGATGTCCTCGGG + Intergenic
934091684 2:88556000-88556022 TAGCTCCTAGGGAAGTCCTGGGG + Intergenic
936887208 2:117326082-117326104 CTGTTTCTAGGGATGCCCTCTGG - Intergenic
936978653 2:118243567-118243589 GAGTCCCTAGGGATGTGCTAAGG + Intergenic
937617500 2:123943643-123943665 CAATTCTTAGGGAAGTCCTAGGG + Intergenic
941298379 2:163769481-163769503 CAGTTGCTAGGGAAGGCCTGTGG + Intergenic
1169090765 20:2860203-2860225 AGGTTCCTAAGGCTGTCCTCAGG - Intronic
1170596428 20:17809402-17809424 CACTTTCTAGGGGTGTCTTCTGG - Intergenic
1171517596 20:25750381-25750403 CAGGTCCTCTGGACGTCCTCTGG - Intergenic
1173230419 20:41192011-41192033 CAGTTCCCAGGCATGTGATCAGG + Intronic
1176179594 20:63743063-63743085 CAGCCCCTGGGGCTGTCCTCGGG - Exonic
1182314115 22:29432270-29432292 CAGTTCCCAGGAATTTGCTCAGG + Intergenic
1183696555 22:39426948-39426970 CAGTGCCTGGGGATGCCATCTGG + Intronic
1184251838 22:43264928-43264950 AATTTCCTAGGGCTGTCCTATGG + Intronic
1184438763 22:44496402-44496424 CAGTTCCTATTGATGAGCTCTGG - Exonic
1185276983 22:49954036-49954058 CTGTTCCTAGGAGTGTCCCCAGG - Intergenic
949859086 3:8489240-8489262 CAGTTCCTAGGCATGTGATGGGG + Intergenic
949896119 3:8768563-8768585 CAGTTCCTCGGGATGTTCAGCGG + Exonic
950107790 3:10399156-10399178 CAGTGGCCAGGTATGTCCTCTGG - Intronic
952878998 3:37971347-37971369 CAGTTGCTGGGGATGGCCTGGGG - Intronic
953367144 3:42354510-42354532 CTGTTCCCAGTGATTTCCTCGGG - Intergenic
953884699 3:46708628-46708650 GAGAGCCCAGGGATGTCCTCAGG + Intronic
955091882 3:55760639-55760661 CATTTAGTTGGGATGTCCTCAGG - Intronic
960038024 3:113121173-113121195 AAGTTCCTAGGGCTGACCCCTGG - Intergenic
961564393 3:127753386-127753408 CAGAACCCAGGGATGTTCTCAGG + Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
966259943 3:177964780-177964802 CAGTTCCTGGGGCTGTCTTTGGG + Intergenic
968278687 3:197459494-197459516 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278700 3:197459554-197459576 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278707 3:197459584-197459606 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278714 3:197459614-197459636 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278721 3:197459644-197459666 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278728 3:197459674-197459696 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278736 3:197459705-197459727 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278776 3:197459859-197459881 CAGTTAGTAGGGATGTGGTCAGG + Intergenic
968278826 3:197460059-197460081 CAGTTAGTAGGGATGTGGTCAGG + Intergenic
975202199 4:71604729-71604751 CAGTTCCTAGGACTGTTCTAAGG - Intergenic
975734327 4:77366880-77366902 CAGTTACTAGCCATGTCCTCGGG - Intronic
976948642 4:90800496-90800518 CATTTCCTAGCTATCTCCTCTGG + Intronic
977026875 4:91830914-91830936 CAACTCCTAGGCATGTCCTAAGG - Intergenic
981134097 4:141190431-141190453 CAGTTCCTAGGGATGTCCTCAGG - Intronic
985361497 4:189180028-189180050 CAGTTTCTATGGCTGGCCTCAGG + Intergenic
985575380 5:671280-671302 CTCTTCCTAGTGATGTCCACAGG - Intronic
985958572 5:3282560-3282582 CAGTTCCTGGAAATGTTCTCTGG - Intergenic
987811634 5:22844102-22844124 CAGTTCATCTGGATGTCTTCCGG - Intronic
990132075 5:52598008-52598030 CAGTTGCAAGGCATGTCCTGAGG + Intergenic
993430764 5:87830018-87830040 CAGTTCCTAATGCTGTACTCTGG + Intergenic
1000281701 5:159787981-159788003 CAGTTCCTAGGGAAGTCTGATGG - Intergenic
1000957823 5:167563047-167563069 CAGTACCTAGGCATGTGCCCAGG - Intronic
1001552201 5:172611193-172611215 TAGTTCCTAGGTACCTCCTCTGG + Intergenic
1007190986 6:40018248-40018270 GATTTCCTAGGGATCTACTCAGG + Intergenic
1007991204 6:46257963-46257985 CAGCTACTAGGGAAGTCCACTGG + Intronic
1012817185 6:104039133-104039155 CAGTGCCTAGGAATGTTGTCTGG - Intergenic
1020082024 7:5291351-5291373 CACTTCCTAGGGCTGCCCTGAGG + Intronic
1022168985 7:27804559-27804581 CAGTTACAAGTGAGGTCCTCAGG + Intronic
1024872758 7:53984811-53984833 CAGTTCCTAGGGAGGACCTCAGG + Intergenic
1025196895 7:56940787-56940809 CACTTCCTAGGGCTGCCCTGGGG - Intergenic
1025675053 7:63636150-63636172 CACTTCCTAGGGCTGCCCTGGGG + Intergenic
1025739482 7:64183726-64183748 CAGTTCCCAGGCATGTCATAGGG + Intronic
1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG + Intergenic
1028509446 7:91607688-91607710 CAATTCTTAGGTATGTCATCAGG - Intergenic
1029434146 7:100552659-100552681 TCCCTCCTAGGGATGTCCTCAGG + Intronic
1035249015 7:157584873-157584895 CATTTCTTAGGACTGTCCTCTGG - Intronic
1039578014 8:38641061-38641083 CAGTTCCTAGAGAGGACCACAGG - Intergenic
1040109527 8:43561023-43561045 CAGCTCCTGGGGATGCGCTCGGG - Intergenic
1040392332 8:46961027-46961049 CGCTTCCTGGGGCTGTCCTCAGG - Intergenic
1041318009 8:56583931-56583953 CAGTTCCTAAGGATCTCCTGGGG + Intergenic
1049134852 8:140887166-140887188 CAGTACCTGGGGAGGTCCACAGG + Intronic
1052427870 9:28328129-28328151 CTTTTCCTAGTGATTTCCTCTGG - Intronic
1053064881 9:35061015-35061037 CAGTTACTATGGATGACTTCCGG - Exonic
1053143385 9:35695943-35695965 CATTTCCTTGTCATGTCCTCAGG - Intergenic
1060452745 9:123758440-123758462 CAGTTACTAAGGATGTATTCTGG - Intronic
1060883800 9:127136590-127136612 CTGCTCCTAGGGTTGTCATCAGG + Intronic
1061924662 9:133800132-133800154 CAGTTCCTGGGGCTGTCCTAGGG + Intronic
1062388086 9:136322739-136322761 CAGTTCCCAGGGACAGCCTCTGG - Intergenic
1187309015 X:18122890-18122912 CTTCTCCTTGGGATGTCCTCTGG + Intergenic
1190925578 X:54900553-54900575 CAGCTCCTAAGGTGGTCCTCTGG + Intergenic
1192552889 X:72068201-72068223 CAGTTCCCAGGGATCTGCTCTGG - Intergenic
1199545618 X:149005048-149005070 CCCTTCCTAGTGATGGCCTCTGG + Intergenic