ID: 981134099

View in Genome Browser
Species Human (GRCh38)
Location 4:141190443-141190465
Sequence CAGGGTTGATCTCAGTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981134099_981134108 26 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134099_981134105 2 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134105 4:141190468-141190490 CAACAGTCACCCAGAAAATTGGG No data
981134099_981134109 27 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134109 4:141190493-141190515 CTACAGTCCTATGACTACAAGGG No data
981134099_981134104 1 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134104 4:141190467-141190489 CCAACAGTCACCCAGAAAATTGG 0: 1
1: 0
2: 3
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981134099 Original CRISPR CAGGGTTGATCTCAGTTCCT AGG (reversed) Intronic