ID: 981134104

View in Genome Browser
Species Human (GRCh38)
Location 4:141190467-141190489
Sequence CCAACAGTCACCCAGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981134099_981134104 1 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134104 4:141190467-141190489 CCAACAGTCACCCAGAAAATTGG 0: 1
1: 0
2: 3
3: 17
4: 202
981134097_981134104 13 Left 981134097 4:141190431-141190453 CCTGAGGACATCCCTAGGAACTG No data
Right 981134104 4:141190467-141190489 CCAACAGTCACCCAGAAAATTGG 0: 1
1: 0
2: 3
3: 17
4: 202
981134098_981134104 2 Left 981134098 4:141190442-141190464 CCCTAGGAACTGAGATCAACCCT No data
Right 981134104 4:141190467-141190489 CCAACAGTCACCCAGAAAATTGG 0: 1
1: 0
2: 3
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981134104 Original CRISPR CCAACAGTCACCCAGAAAAT TGG Intronic