ID: 981134104 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:141190467-141190489 |
Sequence | CCAACAGTCACCCAGAAAAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 223 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 17, 4: 202} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
981134099_981134104 | 1 | Left | 981134099 | 4:141190443-141190465 | CCTAGGAACTGAGATCAACCCTG | No data | ||
Right | 981134104 | 4:141190467-141190489 | CCAACAGTCACCCAGAAAATTGG | 0: 1 1: 0 2: 3 3: 17 4: 202 |
||||
981134097_981134104 | 13 | Left | 981134097 | 4:141190431-141190453 | CCTGAGGACATCCCTAGGAACTG | No data | ||
Right | 981134104 | 4:141190467-141190489 | CCAACAGTCACCCAGAAAATTGG | 0: 1 1: 0 2: 3 3: 17 4: 202 |
||||
981134098_981134104 | 2 | Left | 981134098 | 4:141190442-141190464 | CCCTAGGAACTGAGATCAACCCT | No data | ||
Right | 981134104 | 4:141190467-141190489 | CCAACAGTCACCCAGAAAATTGG | 0: 1 1: 0 2: 3 3: 17 4: 202 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
981134104 | Original CRISPR | CCAACAGTCACCCAGAAAAT TGG | Intronic | ||