ID: 981134105

View in Genome Browser
Species Human (GRCh38)
Location 4:141190468-141190490
Sequence CAACAGTCACCCAGAAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981134098_981134105 3 Left 981134098 4:141190442-141190464 CCCTAGGAACTGAGATCAACCCT No data
Right 981134105 4:141190468-141190490 CAACAGTCACCCAGAAAATTGGG No data
981134099_981134105 2 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134105 4:141190468-141190490 CAACAGTCACCCAGAAAATTGGG No data
981134097_981134105 14 Left 981134097 4:141190431-141190453 CCTGAGGACATCCCTAGGAACTG No data
Right 981134105 4:141190468-141190490 CAACAGTCACCCAGAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981134105 Original CRISPR CAACAGTCACCCAGAAAATT GGG Intronic