ID: 981134108

View in Genome Browser
Species Human (GRCh38)
Location 4:141190492-141190514
Sequence ACTACAGTCCTATGACTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981134099_981134108 26 Left 981134099 4:141190443-141190465 CCTAGGAACTGAGATCAACCCTG No data
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134106_981134108 -8 Left 981134106 4:141190477-141190499 CCCAGAAAATTGGGAACTACAGT 0: 1
1: 0
2: 2
3: 18
4: 250
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134107_981134108 -9 Left 981134107 4:141190478-141190500 CCAGAAAATTGGGAACTACAGTC 0: 1
1: 0
2: 0
3: 15
4: 190
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134101_981134108 8 Left 981134101 4:141190461-141190483 CCCTGGCCAACAGTCACCCAGAA 0: 1
1: 0
2: 6
3: 27
4: 214
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134103_981134108 2 Left 981134103 4:141190467-141190489 CCAACAGTCACCCAGAAAATTGG No data
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134102_981134108 7 Left 981134102 4:141190462-141190484 CCTGGCCAACAGTCACCCAGAAA 0: 1
1: 0
2: 7
3: 26
4: 239
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data
981134098_981134108 27 Left 981134098 4:141190442-141190464 CCCTAGGAACTGAGATCAACCCT No data
Right 981134108 4:141190492-141190514 ACTACAGTCCTATGACTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981134108 Original CRISPR ACTACAGTCCTATGACTACA AGG Intronic