ID: 981138796

View in Genome Browser
Species Human (GRCh38)
Location 4:141242886-141242908
Sequence AAGAATAAAGAGAAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981138796_981138801 21 Left 981138796 4:141242886-141242908 CCAGCCAACTTCTCTTTATTCTT No data
Right 981138801 4:141242930-141242952 TTTTTAATTTTAGCTCTAATGGG No data
981138796_981138800 20 Left 981138796 4:141242886-141242908 CCAGCCAACTTCTCTTTATTCTT No data
Right 981138800 4:141242929-141242951 CTTTTTAATTTTAGCTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981138796 Original CRISPR AAGAATAAAGAGAAGTTGGC TGG (reversed) Intergenic
No off target data available for this crispr