ID: 981144119

View in Genome Browser
Species Human (GRCh38)
Location 4:141305042-141305064
Sequence CTAAGTGTGCCCCAGACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981144119_981144124 24 Left 981144119 4:141305042-141305064 CCCTGAGTCTGGGGCACACTTAG No data
Right 981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG No data
981144119_981144125 30 Left 981144119 4:141305042-141305064 CCCTGAGTCTGGGGCACACTTAG No data
Right 981144125 4:141305095-141305117 GGCTGGAGTAGAGAAGGAAAAGG No data
981144119_981144123 13 Left 981144119 4:141305042-141305064 CCCTGAGTCTGGGGCACACTTAG No data
Right 981144123 4:141305078-141305100 TGCAGGAAGATCACTGTGGCTGG No data
981144119_981144122 9 Left 981144119 4:141305042-141305064 CCCTGAGTCTGGGGCACACTTAG No data
Right 981144122 4:141305074-141305096 GTAATGCAGGAAGATCACTGTGG No data
981144119_981144121 -4 Left 981144119 4:141305042-141305064 CCCTGAGTCTGGGGCACACTTAG No data
Right 981144121 4:141305061-141305083 TTAGTATGTTGAAGTAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981144119 Original CRISPR CTAAGTGTGCCCCAGACTCA GGG (reversed) Intergenic
No off target data available for this crispr