ID: 981144120

View in Genome Browser
Species Human (GRCh38)
Location 4:141305043-141305065
Sequence ACTAAGTGTGCCCCAGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981144120_981144121 -5 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144121 4:141305061-141305083 TTAGTATGTTGAAGTAATGCAGG No data
981144120_981144124 23 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG No data
981144120_981144125 29 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144125 4:141305095-141305117 GGCTGGAGTAGAGAAGGAAAAGG No data
981144120_981144123 12 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144123 4:141305078-141305100 TGCAGGAAGATCACTGTGGCTGG No data
981144120_981144126 30 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144126 4:141305096-141305118 GCTGGAGTAGAGAAGGAAAAGGG No data
981144120_981144122 8 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144122 4:141305074-141305096 GTAATGCAGGAAGATCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981144120 Original CRISPR ACTAAGTGTGCCCCAGACTC AGG (reversed) Intergenic
No off target data available for this crispr