ID: 981144124

View in Genome Browser
Species Human (GRCh38)
Location 4:141305089-141305111
Sequence CACTGTGGCTGGAGTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981144120_981144124 23 Left 981144120 4:141305043-141305065 CCTGAGTCTGGGGCACACTTAGT No data
Right 981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG No data
981144119_981144124 24 Left 981144119 4:141305042-141305064 CCCTGAGTCTGGGGCACACTTAG No data
Right 981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981144124 Original CRISPR CACTGTGGCTGGAGTAGAGA AGG Intergenic
No off target data available for this crispr