ID: 981144296

View in Genome Browser
Species Human (GRCh38)
Location 4:141307219-141307241
Sequence CTGGAAAATAACACTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981144296_981144301 15 Left 981144296 4:141307219-141307241 CCCTCATCAGTGTTATTTTCCAG No data
Right 981144301 4:141307257-141307279 TTGCAGTGAACAACCTAACAGGG No data
981144296_981144300 14 Left 981144296 4:141307219-141307241 CCCTCATCAGTGTTATTTTCCAG No data
Right 981144300 4:141307256-141307278 TTTGCAGTGAACAACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981144296 Original CRISPR CTGGAAAATAACACTGATGA GGG (reversed) Intergenic
No off target data available for this crispr