ID: 981145359

View in Genome Browser
Species Human (GRCh38)
Location 4:141317621-141317643
Sequence CTGGAGAAACAAAGTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981145355_981145359 2 Left 981145355 4:141317596-141317618 CCCTTGCCAGTTCTTTTGCAAAA No data
Right 981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG No data
981145357_981145359 -4 Left 981145357 4:141317602-141317624 CCAGTTCTTTTGCAAAACTCTGG No data
Right 981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG No data
981145354_981145359 26 Left 981145354 4:141317572-141317594 CCAGGAGGTGCTAGTTGAATCTG No data
Right 981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG No data
981145356_981145359 1 Left 981145356 4:141317597-141317619 CCTTGCCAGTTCTTTTGCAAAAC No data
Right 981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981145359 Original CRISPR CTGGAGAAACAAAGTGTGCA AGG Intergenic
No off target data available for this crispr