ID: 981148711

View in Genome Browser
Species Human (GRCh38)
Location 4:141356111-141356133
Sequence CTGGCTATGACGTCGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981148708_981148711 -3 Left 981148708 4:141356091-141356113 CCTTGCACTACAACGTTAGGCTG No data
Right 981148711 4:141356111-141356133 CTGGCTATGACGTCGCTAGGTGG No data
981148705_981148711 26 Left 981148705 4:141356062-141356084 CCAGCATCACCACAAACATGTGA 0: 60
1: 160
2: 323
3: 368
4: 518
Right 981148711 4:141356111-141356133 CTGGCTATGACGTCGCTAGGTGG No data
981148706_981148711 17 Left 981148706 4:141356071-141356093 CCACAAACATGTGAATAATGCCT No data
Right 981148711 4:141356111-141356133 CTGGCTATGACGTCGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981148711 Original CRISPR CTGGCTATGACGTCGCTAGG TGG Intergenic
No off target data available for this crispr