ID: 981157070

View in Genome Browser
Species Human (GRCh38)
Location 4:141450820-141450842
Sequence CAGGACAAAGAAGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981157070_981157074 23 Left 981157070 4:141450820-141450842 CCTTCCTCCTCTTCTTTGTCCTG No data
Right 981157074 4:141450866-141450888 TTTGACTTTCATCTTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981157070 Original CRISPR CAGGACAAAGAAGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr