ID: 981164788

View in Genome Browser
Species Human (GRCh38)
Location 4:141544908-141544930
Sequence GAAGTCTGTAGAATGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981164788_981164790 -5 Left 981164788 4:141544908-141544930 CCATAGATCATTCTACAGACTTC No data
Right 981164790 4:141544926-141544948 ACTTCCGTAAACCAAGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981164788 Original CRISPR GAAGTCTGTAGAATGATCTA TGG (reversed) Intergenic
No off target data available for this crispr