ID: 981166710

View in Genome Browser
Species Human (GRCh38)
Location 4:141567730-141567752
Sequence CTGTAGGATCAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981166710_981166720 30 Left 981166710 4:141567730-141567752 CCCTCCCCATTCTGATCCTACAG No data
Right 981166720 4:141567783-141567805 AAATCAAATGAATGTAATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981166710 Original CRISPR CTGTAGGATCAGAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr