ID: 981173868

View in Genome Browser
Species Human (GRCh38)
Location 4:141657896-141657918
Sequence CTTGATTATAACTATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981173868_981173869 23 Left 981173868 4:141657896-141657918 CCAGCAACATAGTTATAATCAAG 0: 1
1: 0
2: 5
3: 17
4: 140
Right 981173869 4:141657942-141657964 ATGTTATACTTTTATATGACTGG 0: 4
1: 23
2: 109
3: 286
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981173868 Original CRISPR CTTGATTATAACTATGTTGC TGG (reversed) Intronic
900790050 1:4673986-4674008 TTTTAGTATAACTATGTTCCAGG + Intronic
908259874 1:62331732-62331754 ATTGATTACAACTAAGTTCCAGG - Intergenic
909186268 1:72490384-72490406 CTTGATTATGAGTATGTTCCTGG - Intergenic
917766566 1:178226119-178226141 CTAGATGATAACTATGCTACTGG - Intronic
917833555 1:178920324-178920346 TTTGATTACACCTATGTTTCAGG + Intronic
917990635 1:180374390-180374412 CTAGATTACTACTATGTTTCAGG - Intronic
920561496 1:206942041-206942063 CTTGGTTATTTCTTTGTTGCAGG + Intronic
920856240 1:209664584-209664606 GTTGTTTACTACTATGTTGCTGG - Intergenic
921944032 1:220874324-220874346 TTTCATCATAACAATGTTGCTGG + Intergenic
923423967 1:233849730-233849752 CTTGATTATTCATATGTTGTTGG + Intergenic
1063876677 10:10485816-10485838 CCTGATTATAATGATGTTGTAGG - Intergenic
1065670578 10:28112732-28112754 CATGATTATTACTATGTGGAAGG + Intronic
1066498629 10:35968343-35968365 CTTGATTATAGCAAGGTTGTAGG + Intergenic
1066505904 10:36042518-36042540 TTTGATTATAGCTATTTTGGTGG + Intergenic
1066626481 10:37412145-37412167 CTTGATTATAGCAAGGTTGTAGG + Intergenic
1069636776 10:69929905-69929927 TTTAATTCTAACTGTGTTGCTGG - Intronic
1072112130 10:92332817-92332839 CTTGATTAAAAGTATGTGGGAGG - Intronic
1074838851 10:117328161-117328183 CTTGAGTATAACTTTGGTGATGG - Intronic
1075469133 10:122674806-122674828 CTTGATTTTAACTACCTTACAGG - Intergenic
1076273469 10:129176421-129176443 CTGGGTTGTAACTCTGTTGCAGG + Intergenic
1081285936 11:41270276-41270298 CTTGACTATAGCAATTTTGCAGG + Intronic
1081915061 11:46725450-46725472 ATTGATGATAAATAAGTTGCAGG + Intronic
1082613527 11:55331777-55331799 CTTTGTTATAAGTATGATGCTGG + Intergenic
1085541584 11:77275483-77275505 CTTGACTATAACTCTCTTGGTGG - Intronic
1087061135 11:93978702-93978724 CTTGATTAGAACAATGTTAATGG - Intergenic
1087355319 11:97086263-97086285 CTTGGTTATAACTACGTTAGAGG + Intergenic
1089032039 11:115341229-115341251 CTTGAGTATATTTCTGTTGCCGG + Intronic
1090696089 11:129243554-129243576 CTTGATGAGAACTATGTTTTAGG - Intronic
1093005926 12:14050527-14050549 ATTGATTATTTCTATGTTCCCGG - Intergenic
1093631002 12:21409131-21409153 CTTGATGATAATTCTGTTGGAGG + Intronic
1094823799 12:34250350-34250372 CTTTATTAAAATCATGTTGCAGG + Intergenic
1095821117 12:46479457-46479479 CTTGAATCTAACCATGTTTCAGG + Intergenic
1097791862 12:63823514-63823536 CCACATTATAACTATGCTGCGGG + Intergenic
1099020318 12:77395570-77395592 CTTGATTATAACCATGTGGCTGG + Intergenic
1100168161 12:91941686-91941708 ATTGATTATATCTATGTGCCAGG - Intergenic
1100490976 12:95077577-95077599 CTAGATTAGAGCTATGTTGTTGG + Exonic
1101198023 12:102405535-102405557 CTTAATAATATCTATTTTGCGGG - Intronic
1102894932 12:116591240-116591262 GTTCATTATAACATTGTTGCCGG - Intergenic
1103546043 12:121702362-121702384 CTTTATTATACCTATTTTACAGG - Intergenic
1105044302 12:132988982-132989004 CATGATTATACCAAGGTTGCAGG - Intronic
1105271389 13:18878722-18878744 ATTGATTATATCTAGGTTCCTGG + Intergenic
1105575825 13:21650663-21650685 CTTGATAATAACAATGGTGGTGG - Intergenic
1107266108 13:38556910-38556932 CATGATTACAGCTAGGTTGCAGG - Intergenic
1108770329 13:53693070-53693092 CTTGATTCACACTATGTGGCAGG + Intergenic
1109085030 13:57959806-57959828 CTTGACTATAAGTTTGTTTCTGG + Intergenic
1110203094 13:72876777-72876799 AGTGATTATAGCAATGTTGCAGG - Intronic
1111166689 13:84466739-84466761 CTTGATTTTTTCTATGTTGAAGG - Intergenic
1115075180 14:29380549-29380571 TTTGATTAATAATATGTTGCTGG - Intergenic
1115735330 14:36321432-36321454 CTTTATTATAACGATGTTTGTGG + Intergenic
1115923152 14:38400724-38400746 CATGATTGTAAATGTGTTGCAGG + Intergenic
1116639586 14:47443959-47443981 CTAGATTATAACTTTATTGAAGG + Intronic
1120937996 14:89917683-89917705 TTTGATTATAATCATGTTGCTGG - Intronic
1124449173 15:29769823-29769845 CTTGATAATGACTATGTTACTGG + Intronic
1125568636 15:40696784-40696806 TTTGATTTTAACTATTCTGCTGG + Intronic
1126222862 15:46234997-46235019 ATTGATTATATCTAGGTTCCTGG - Intergenic
1128917363 15:71575873-71575895 CTAGATTGTAAGTATCTTGCAGG - Intronic
1129044471 15:72721561-72721583 AAAGATTATAACTATGTTGCAGG + Intronic
1129507265 15:76092134-76092156 TTTCATTATATCCATGTTGCTGG - Intronic
1137706525 16:50539442-50539464 CTGGATTCTAACTCTCTTGCAGG - Intergenic
1141213948 16:82006914-82006936 TTTGAATATAACTAGGTAGCAGG + Intronic
1146426129 17:32741064-32741086 CTTAAATATAATTATATTGCTGG + Intronic
1146684549 17:34832500-34832522 CTTCATTATAATTACCTTGCAGG - Intergenic
1148681145 17:49474165-49474187 CGTGATTATATTTATTTTGCAGG + Intronic
1150953131 17:69824441-69824463 CTAGAGAATAACTATGCTGCTGG - Intergenic
1154261449 18:12837075-12837097 CTTGTTTATTACTATAGTGCTGG + Intronic
1154504673 18:15023917-15023939 GTTGATTATAAGAAGGTTGCAGG + Intergenic
1155370394 18:25093731-25093753 CTTGATTATAATTATGTAAGAGG + Intronic
1155558090 18:27043893-27043915 CTTGTTTATGACTCTGTTCCAGG + Intronic
1155823675 18:30410844-30410866 CTTTATTATAAATATATTTCTGG + Intergenic
1156437394 18:37147254-37147276 CACGATTATAAATATGTTGCTGG - Intronic
1157029229 18:43884785-43884807 CTTGAAGATGACTATGTAGCTGG + Intergenic
1159689974 18:71475747-71475769 CTTGCTTAGAAATATGTTGTAGG + Intergenic
1165249824 19:34520982-34521004 CTTGATGATAACTCTGTCACTGG - Intergenic
926458168 2:13095013-13095035 CTTGACTATATTTATGTTTCAGG - Intergenic
926470346 2:13247692-13247714 CCTGATTATATTTATGTTCCTGG + Intergenic
926958693 2:18330970-18330992 CTTGATTACAACTTTGTTGTGGG + Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928680784 2:33700190-33700212 CTTCATTATAGCTCTTTTGCTGG + Intergenic
928748683 2:34445952-34445974 CTGGATTATCACTATGTTCCAGG + Intergenic
931423098 2:62146205-62146227 CTTGATAATAAGTGTGTTACTGG + Intronic
931448701 2:62349437-62349459 CTTAATTATAACTATATTTCTGG - Intergenic
932068946 2:68596592-68596614 TTTGAATAAAACTATTTTGCAGG - Intronic
935448121 2:103178240-103178262 CTTGATTATAAATGTTTTCCTGG - Intergenic
936069932 2:109360672-109360694 CTTGATTATAGCAAGGTTGCAGG - Intronic
937672005 2:124547862-124547884 CTTGAATACAACCAGGTTGCTGG - Intronic
937946531 2:127343625-127343647 AATAATTATAACTGTGTTGCTGG + Intronic
938503862 2:131854127-131854149 GTTGATTATAAGAAGGTTGCAGG + Intergenic
938825053 2:134996483-134996505 CTTGATTAGTGCTATGTTGTAGG + Intronic
939632348 2:144540195-144540217 CTTAATCATATCAATGTTGCAGG + Intergenic
940536322 2:154949524-154949546 TTTGATTTTAGCTATCTTGCAGG + Intergenic
941041538 2:160628870-160628892 CTTTATGATACCTGTGTTGCAGG + Intergenic
941263948 2:163335625-163335647 CTAGATTATAAATTTGATGCTGG - Intergenic
946668884 2:222081060-222081082 CCTGATGATTGCTATGTTGCTGG + Intergenic
947433120 2:230048204-230048226 CTTCATTATACCCATTTTGCAGG + Intronic
1169740450 20:8888084-8888106 CTTGGTTATAAAAATGTTGATGG - Intronic
1170100829 20:12697475-12697497 GTTGATTTTTACTATGTTGGTGG + Intergenic
1177050896 21:16231673-16231695 CTTCTTTATAATTATGTGGCAGG + Intergenic
1177992566 21:28056022-28056044 GTTGATTATAAGAAGGTTGCAGG - Intergenic
1183169279 22:36173641-36173663 CTTGATTTTAAGTCTGTTGTGGG - Intergenic
1184210385 22:43031851-43031873 CTTGATTTTATTTATGTTCCAGG + Intergenic
950252399 3:11477050-11477072 CTTGATTATAATTATTTAACTGG + Intronic
954975830 3:54693479-54693501 CTTGATGATAACTATGTTACTGG + Intronic
957515690 3:81247959-81247981 CTTGATAATAACTATGTTACTGG + Intergenic
961234373 3:125351857-125351879 TTTGATTATAGCTATGCTGGTGG - Intronic
962130440 3:132667802-132667824 CTTGTTTATACATAAGTTGCGGG - Intronic
964899104 3:161636003-161636025 CTTGATTATAGAAATGTTGATGG + Intergenic
965469180 3:169069341-169069363 ATTGATTAAAACTGTGTTACTGG + Intergenic
967570398 3:191021321-191021343 CTTTATTATATATATGTTTCTGG + Intergenic
967960324 3:194915977-194915999 CTTCATTATAAGTATGATGTCGG + Intergenic
970892937 4:21067875-21067897 CTTGATAATATTTATGTTGATGG - Intronic
972959264 4:44432250-44432272 CTTAATTATATCTATGTTGTAGG - Intronic
975306984 4:72861146-72861168 CCTGATTATAATCATGTTGGGGG + Intergenic
980539391 4:134174356-134174378 CTTGATAATAAATATGTTACTGG - Intergenic
981173868 4:141657896-141657918 CTTGATTATAACTATGTTGCTGG - Intronic
983093265 4:163531716-163531738 GGTGATTATGACAATGTTGCAGG + Intronic
988842816 5:35099458-35099480 CTTGATAATAACTATGTTACTGG + Intronic
990813944 5:59761839-59761861 CTTAATAATAACTATGTTGCTGG - Intronic
991527996 5:67583957-67583979 AATGATTATAACAATGTTGTAGG + Intergenic
994159794 5:96544402-96544424 AGTGATTATAACAATGTGGCTGG - Intronic
994959607 5:106581989-106582011 CTTGAGTATTACTAGGTAGCAGG - Intergenic
995002063 5:107145274-107145296 GCTGATTATTAATATGTTGCTGG + Intergenic
999834073 5:155350533-155350555 CGTGATTATAGCAATATTGCAGG + Intergenic
1003996443 6:11545655-11545677 CTTGATAACAACTGTGTTACTGG + Intronic
1005523008 6:26616528-26616550 AGTGATTATAGCAATGTTGCAGG + Intergenic
1007041257 6:38724584-38724606 CTGGATTATACCTATTTTCCTGG + Intronic
1008010410 6:46461233-46461255 CTTGATTATATCAGTGTTGCAGG - Intronic
1011642939 6:89432698-89432720 CTTGACTATAAGTATCTTGTTGG - Intergenic
1012203313 6:96433447-96433469 CTTTATTATATCTATTTTTCTGG + Intergenic
1015267843 6:131307083-131307105 AATGATTATGACTATGTTGAAGG - Intergenic
1015347084 6:132173007-132173029 CTTGTTTTTAATTATGTTTCTGG + Intergenic
1016735481 6:147474269-147474291 TTTGATTATGACCATTTTGCAGG - Intergenic
1017655867 6:156629074-156629096 CTTGATAATAAATATGTTACTGG + Intergenic
1020407259 7:7851580-7851602 CTTGATTATAACCATCCTGCTGG + Intronic
1021254540 7:18375010-18375032 CTTGATAATAATTATGTTACTGG + Intronic
1028453303 7:91010597-91010619 GTTGATTTTAACAAAGTTGCAGG - Intronic
1028633971 7:92966626-92966648 CTTGATAAAAATTATGTTGGAGG + Intergenic
1030224589 7:107135508-107135530 AGTGATTATAACAAGGTTGCAGG + Intronic
1030411297 7:109183275-109183297 CATTATTATATTTATGTTGCGGG - Intergenic
1030916617 7:115322369-115322391 CTAGATTATAACTTCTTTGCAGG + Intergenic
1030981950 7:116196564-116196586 AATGATAATAACTATGTTACTGG - Intergenic
1031273709 7:119689523-119689545 CATGATCAGAACTATGTTGCTGG + Intergenic
1031415283 7:121488794-121488816 ATACATTATAACTATATTGCGGG + Intergenic
1031703239 7:124951136-124951158 CTAGTTTATAACTATTTTTCAGG + Intergenic
1034377300 7:150657343-150657365 ATGGATTATAACTATGATGCAGG + Intergenic
1042290372 8:67164981-67165003 TTTGATTATAAAAAAGTTGCAGG + Intronic
1042408526 8:68434639-68434661 GTTAATTATAATTTTGTTGCTGG - Intronic
1044803313 8:95979145-95979167 ATTGATTACCACTATGTTCCAGG - Intergenic
1045223999 8:100226803-100226825 CATGATTATATTTATGTTGTGGG - Intronic
1045274058 8:100685801-100685823 CTTTATAATTACTATGTTGTAGG - Intronic
1046914878 8:119669332-119669354 ATTGAGTATAACCATGTTTCAGG + Intronic
1047315718 8:123731194-123731216 CTGGATTATACCAATGATGCGGG + Intronic
1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG + Intronic
1056614069 9:88147495-88147517 CTAGATTATAGCAAGGTTGCAGG + Intergenic
1056696730 9:88863086-88863108 CTTGAATAGAACTGTGTTGTTGG - Intergenic
1058957752 9:109964714-109964736 CTTGAGTATAACTTTGCTCCTGG + Intronic
1062589938 9:137269432-137269454 GTTATTTATAACTATGTTCCCGG - Intronic
1193371536 X:80703899-80703921 CTTGATTATCACTATTTTATTGG - Intronic
1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG + Intergenic
1196531658 X:116794778-116794800 TTTGTTTATAGCTATCTTGCTGG + Intergenic
1196576729 X:117326847-117326869 CTTTATTATAACTCTCTTACAGG + Intergenic
1197137684 X:123082154-123082176 CTTGATGACTACTTTGTTGCTGG + Intergenic
1197203724 X:123771906-123771928 CTTGAGGAAAACTATTTTGCTGG - Intergenic
1197458601 X:126709550-126709572 CTTGAGTATAACTATGATCGGGG - Intergenic