ID: 981175929

View in Genome Browser
Species Human (GRCh38)
Location 4:141683325-141683347
Sequence CTTTGGAAGGGCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266286
Summary {0: 8, 1: 1132, 2: 25663, 3: 79938, 4: 159545}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981175922_981175929 -8 Left 981175922 4:141683310-141683332 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981175929 Original CRISPR CTTTGGAAGGGCAAGGTGGG TGG Intronic
Too many off-targets to display for this crispr