ID: 981176803

View in Genome Browser
Species Human (GRCh38)
Location 4:141691694-141691716
Sequence GGGCAGGCTAATGCAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 1, 2: 23, 3: 123, 4: 583}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981176798_981176803 -7 Left 981176798 4:141691678-141691700 CCATGTCTCATATCCTGGGCAGG 0: 1
1: 3
2: 34
3: 290
4: 1432
Right 981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG 0: 1
1: 1
2: 23
3: 123
4: 583
981176794_981176803 14 Left 981176794 4:141691657-141691679 CCAAAATGATCTCCTTTGACTCC 0: 1250
1: 1855
2: 1529
3: 901
4: 676
Right 981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG 0: 1
1: 1
2: 23
3: 123
4: 583
981176795_981176803 2 Left 981176795 4:141691669-141691691 CCTTTGACTCCATGTCTCATATC 0: 162
1: 1534
2: 2017
3: 1422
4: 977
Right 981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG 0: 1
1: 1
2: 23
3: 123
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981176803 Original CRISPR GGGCAGGCTAATGCAAAGGG TGG Intronic
901717545 1:11168579-11168601 TGGCAGCCTTCTGCAAAGGGTGG - Intronic
902554847 1:17240830-17240852 GGGCAGGCTGGTGCAGAGGCTGG + Intronic
903188736 1:21644429-21644451 GGGGAGGCTGAGGCAAAGAGAGG - Intronic
903789837 1:25885302-25885324 GGGCAGGTGAATGGAGAGGGTGG - Intronic
904959080 1:34316704-34316726 CGGCACACTGATGCAAAGGGTGG - Intergenic
906204287 1:43979040-43979062 GGTCAGGCTCGTCCAAAGGGTGG - Intronic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
906937373 1:50226009-50226031 GGGCATGCAGATGCAAGGGGTGG - Intergenic
907315485 1:53568162-53568184 GGGCATGCTGATGTAAAGGGTGG - Intronic
907863046 1:58372222-58372244 GGAAATGCTGATGCAAAGGGTGG - Intronic
908407682 1:63831034-63831056 GGGCATGCTGATGCAAGAGGTGG + Intronic
908620713 1:65976178-65976200 GGGCATGCTGATTCAAGGGGTGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909068350 1:70963139-70963161 GGTCACGCCAATGCAAAAGGTGG + Intronic
909405337 1:75282153-75282175 GGTCACGCTAATGCAAGAGGTGG - Intronic
909773579 1:79457121-79457143 GGGCACACTGATGCAAGGGGTGG - Intergenic
910256062 1:85248684-85248706 GGTCATGCTAATGCAAGAGGTGG + Intergenic
911190861 1:94947200-94947222 GGGCTGGCTTATGCAAAGCCAGG - Intergenic
911829853 1:102536872-102536894 GGGAATGCTGATGCAAAGGGTGG + Intergenic
911985418 1:104616464-104616486 GGGCATGCTTATGCAAGAGGTGG + Intergenic
912052004 1:105541555-105541577 GGGCAGGCTGATGCAAGAGGTGG + Intergenic
912722328 1:112030644-112030666 GGGCAGGGGAATGCCAAAGGGGG + Intergenic
912735998 1:112149916-112149938 GGGCATGCTGAGGCAAGGGGTGG - Intergenic
912907020 1:113718274-113718296 GGTCACGCTGATGCAAAAGGTGG + Intronic
913115830 1:115696106-115696128 GGCCAGGCAAAAGCAAAGGGGGG - Exonic
913254139 1:116938992-116939014 GGTCACGCTAATGCAAGAGGTGG + Intronic
913396542 1:118377938-118377960 GGGCATGCTGATGCAAGGAGTGG - Intergenic
914230592 1:145761924-145761946 GGTCATGCTGATGCAAAAGGTGG - Intronic
914811309 1:151030400-151030422 GAGAAGGCAAAGGCAAAGGGGGG - Intronic
915096898 1:153469526-153469548 GGGCAGGCTAATGGAGAGGAAGG - Intergenic
915689643 1:157675911-157675933 GGGCACACTGATGCAAAGAGTGG - Intronic
915787027 1:158624398-158624420 GGGCACACTGATGCAAGGGGTGG - Intronic
916411439 1:164550881-164550903 GGTCAGGCTGATGCAAGAGGTGG + Intergenic
916790382 1:168120212-168120234 GGGCATGCTGATGCAAGGGGTGG - Intronic
916829310 1:168474793-168474815 GAGCATGCTGATGCAAAGGGTGG - Intergenic
918844829 1:189595347-189595369 GGGCATGCTGATGCAAGAGGTGG - Intergenic
918936683 1:190930198-190930220 GGACATGCTGATGCAAAAGGTGG - Intergenic
918993523 1:191728737-191728759 GGGCGTGCTGATGCAAAAGGTGG + Intergenic
919715915 1:200776540-200776562 GGGCAGGCTTGTGCACAGGAAGG + Intronic
919924731 1:202186424-202186446 GGGCAGGTGAGTGCATAGGGTGG + Intergenic
920800576 1:209183650-209183672 GGGCATGCTGATACAAGGGGTGG - Intergenic
920895864 1:210049012-210049034 GGTCATGCTGATGCAAGGGGTGG + Intronic
921516043 1:216093463-216093485 GGACAGGCTGGTGCAAAGCGTGG - Intronic
921594282 1:217037957-217037979 GGTCATGCTGATGCAAAAGGGGG + Intronic
921758281 1:218883612-218883634 GGGCACACTGATGCAAGGGGTGG + Intergenic
921773619 1:219071946-219071968 GGTCATGCTGATGCAAAAGGTGG - Intergenic
922571445 1:226636716-226636738 GGGCTGGCTAATCCCATGGGTGG - Intronic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
924813423 1:247422899-247422921 GGGCAGGCAAAAGCAAACGAGGG + Intronic
1062770426 10:96084-96106 GGGCATGCTGATGCAAAAGGTGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1065226139 10:23545508-23545530 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1065320362 10:24503372-24503394 GAGGAAGCTAATGCAAAGGATGG - Intronic
1065534289 10:26701946-26701968 GGTCACACTGATGCAAAGGGTGG - Intronic
1067351603 10:45481035-45481057 GGTCATGCTAATGCAAGAGGTGG - Intronic
1068404299 10:56570208-56570230 GGGCATGCTGATACAAAAGGTGG + Intergenic
1068452598 10:57211698-57211720 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1068805711 10:61192213-61192235 GGTCACGCTAATGCAACAGGTGG + Intergenic
1069763823 10:70836553-70836575 GGAAAGGCAAAGGCAAAGGGAGG - Intronic
1070423202 10:76258605-76258627 GGGAAGGGTAAAGCAAAGAGAGG - Intronic
1073922059 10:108470637-108470659 GGTCATGCTAATGCCAAAGGTGG + Intergenic
1073994062 10:109295399-109295421 GGTCACGCTGATGCAAGGGGTGG - Intergenic
1074069206 10:110049524-110049546 GGTCACGCTGATGCAAGGGGTGG - Intronic
1075263037 10:120979459-120979481 TGGCAGGCTGCTGCAAAGGCGGG - Intergenic
1076187041 10:128458220-128458242 GGGGAGGCTCAGGCAGAGGGTGG + Intergenic
1077740775 11:4843039-4843061 GGGCATGCTGATGCAAGGCGTGG + Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1078454221 11:11462592-11462614 GGGCAGCCTAAAGAAAAGGAAGG - Intronic
1079511552 11:21216556-21216578 GGGCATGCTGATGCAAGAGGTGG - Intronic
1079546889 11:21643539-21643561 GGGCACACTGATGCAAAAGGTGG - Intergenic
1079559370 11:21803524-21803546 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1080192707 11:29570742-29570764 GGGCATACTGATGCAAGGGGTGG + Intergenic
1080268046 11:30422210-30422232 AAGCAGGCAAATGCAAAGGTGGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080477389 11:32608438-32608460 GGTCACGCTAATGCAAGAGGTGG + Intronic
1081008086 11:37773671-37773693 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1081045551 11:38269459-38269481 GGGCACACTGATGCAAGGGGTGG + Intergenic
1081315509 11:41625179-41625201 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1081358556 11:42144331-42144353 CGGCATGCTGATGCAAGGGGTGG + Intergenic
1081939498 11:46928674-46928696 GGTCATGCTGATGCAAAGGTGGG - Intergenic
1082827065 11:57587609-57587631 GGGCATGCTGGTGCAAGGGGTGG - Intergenic
1083265407 11:61544551-61544573 GGGCAGGTCAAGGCAGAGGGAGG + Intronic
1083782665 11:64926166-64926188 GGGCAGACCAAGGCCAAGGGTGG + Intronic
1084154857 11:67307774-67307796 AGGCAGGATAATGCAGTGGGGGG + Intronic
1086414219 11:86572426-86572448 GGGCAGTGGAAAGCAAAGGGAGG - Intronic
1086669785 11:89532332-89532354 GGGCATGCTGCTGCAAGGGGTGG - Intergenic
1086995672 11:93353289-93353311 GGTCATGCTGATGCAAAAGGTGG + Intronic
1087474260 11:98617677-98617699 GGGCACACTGATGCAAGGGGTGG + Intergenic
1087497404 11:98908406-98908428 GGTCAGGCTGATGCAAGAGGTGG - Intergenic
1087731175 11:101779913-101779935 GGCCATGCTAATGCAAGAGGTGG - Intronic
1087807231 11:102568518-102568540 GGGCATTCTGATGCAAAGGCTGG + Intergenic
1088388757 11:109290402-109290424 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1088397241 11:109382221-109382243 GGGCACGATGATGCAAGGGGTGG + Intergenic
1088426895 11:109714406-109714428 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1088834456 11:113566311-113566333 GAGGAGGCTAAGGCAAAGTGGGG + Intergenic
1088953790 11:114598231-114598253 GGGCACACTAACGCAAGGGGTGG + Intergenic
1089646517 11:119883953-119883975 GGGGAGGCTGATGTAAAGAGAGG - Intergenic
1089746243 11:120619137-120619159 GGGCATACTAGTGCAAGGGGTGG - Intronic
1090215144 11:124954949-124954971 GAGAAGGCTAATAAAAAGGGTGG - Intronic
1090562940 11:127952437-127952459 GGGCAAGATAATGTAAATGGAGG + Intergenic
1090756289 11:129794717-129794739 GGGCACACTAATGCAAGGGGTGG + Intergenic
1092944244 12:13438534-13438556 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1093123328 12:15299597-15299619 GGTCATGCTGATGCAAAAGGTGG + Intronic
1093207126 12:16264207-16264229 GGTCATGCTAATGCAAGAGGTGG - Intronic
1093238500 12:16640690-16640712 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1093350949 12:18102885-18102907 GGGCATGCTGATGCAAGAGGTGG + Intronic
1093478824 12:19583825-19583847 GGGCATGCTGATGCAAGGGGTGG - Intronic
1095252792 12:39998455-39998477 GGTCATGCTGATGCAAAAGGTGG - Intronic
1095731484 12:45511213-45511235 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1096050811 12:48605989-48606011 GGGCACGCTGATACAAAGGGTGG + Intergenic
1096526204 12:52211827-52211849 GGGCATGCTCCTGCAGAGGGAGG + Intergenic
1096863806 12:54549514-54549536 GGGCAGGCTGAGGAGAAGGGAGG + Exonic
1096960177 12:55569679-55569701 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1097142033 12:56909845-56909867 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1097302695 12:58035463-58035485 GGGCACACTGATGCAAGGGGTGG + Intergenic
1097492743 12:60291004-60291026 GGGCATGCTGATGAAAGGGGTGG - Intergenic
1097501485 12:60409628-60409650 GGGCATGCTGATGCATGGGGTGG + Intergenic
1098144899 12:67488239-67488261 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1098486052 12:71023208-71023230 AGGCAGGACAATTCAAAGGGTGG + Intergenic
1098493794 12:71111983-71112005 GGTCATGCTGATGCAAAAGGTGG + Intronic
1098559046 12:71851744-71851766 GGGCACACTGATGCAAGGGGTGG + Intronic
1098686151 12:73424158-73424180 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1098944334 12:76573475-76573497 GGGCATGCTGATGCAAAAGGTGG + Intergenic
1099025009 12:77454745-77454767 GGGAAGGGTAATGAAAAGGTGGG + Intergenic
1099229238 12:80003354-80003376 GAGCATGCTGATGCAAGGGGTGG + Intergenic
1099379630 12:81938502-81938524 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1099581364 12:84451217-84451239 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1099780140 12:87183500-87183522 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1099905076 12:88761785-88761807 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1099911390 12:88838606-88838628 CGGCATGCTGATGCAAAAGGTGG + Intergenic
1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG + Intergenic
1100072174 12:90734633-90734655 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1101516304 12:105438755-105438777 GGGCATGCCAGTGCAAGGGGTGG + Intergenic
1101692823 12:107097213-107097235 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1103223657 12:119267755-119267777 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104116007 12:125749409-125749431 GGGCACACCAATGCAAGGGGTGG - Intergenic
1106262242 13:28077978-28078000 GGGCATGCTGATGCAAGAGGTGG + Intronic
1106834456 13:33618877-33618899 GGGCAGGGTACTGAAAAGGAGGG + Intergenic
1106848204 13:33760522-33760544 GGCCAGGCTTATGCTAAGTGTGG + Intergenic
1107330773 13:39296943-39296965 GGGCATGCTGATGCAAGGGTGGG - Intergenic
1108927462 13:55770302-55770324 GGGCAGGTTGATGCAAGGGCAGG - Intergenic
1109109113 13:58293144-58293166 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1109130110 13:58574521-58574543 GGGCATGCTAATGTAAGAGGTGG + Intergenic
1109503337 13:63267224-63267246 GGGCACACTGATGCAATGGGTGG + Intergenic
1109524469 13:63557413-63557435 GGGCATGCTGATGCAAGGTGTGG - Intergenic
1109616270 13:64837526-64837548 GGGCATGCTGATGCAAAGGGTGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1110902122 13:80836929-80836951 GGCCACACTAATGCAAGGGGTGG + Intergenic
1111222355 13:85220935-85220957 GGGCACACTGATGCAAGGGGTGG - Intergenic
1111372087 13:87332773-87332795 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1112568152 13:100568982-100569004 GGGCATGCTGATGCAAGAGGTGG + Intronic
1112621735 13:101060132-101060154 AGGTAGGCTGATGCAAAGGTGGG + Intronic
1112807959 13:103183762-103183784 TGGGTGGCTCATGCAAAGGGAGG + Intergenic
1112951063 13:104997565-104997587 GGGCATGCCATTGCAGAGGGTGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1113166936 13:107452987-107453009 GGTCAGGCTGATGCAAGAGGTGG + Intronic
1114936835 14:27549076-27549098 GGTCAGGCTGATGCAAGAGGTGG - Intergenic
1115068577 14:29294978-29295000 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1115277361 14:31623068-31623090 GGACATGCTGATGCAAGGGGTGG - Intronic
1115289195 14:31751535-31751557 GGGCATGCTGATGCAAGGGGTGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116275307 14:42824759-42824781 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1116296591 14:43119338-43119360 GGCCATGCTGATGCAAAAGGTGG + Intergenic
1116356338 14:43936349-43936371 GGTCACGCTAATGCAAGAGGTGG + Intergenic
1116485576 14:45444391-45444413 GGGCATGTTGATGCAAGGGGTGG - Intergenic
1116528391 14:45935224-45935246 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1116625030 14:47253531-47253553 GGGCATGCTGATGCAAGAGGTGG + Intronic
1116697561 14:48196688-48196710 GCTCATGCTAATGCAGAGGGCGG - Intergenic
1116742727 14:48776912-48776934 GGGCATGCAGATGCAAGGGGTGG - Intergenic
1117304393 14:54459575-54459597 GGTCAGGACGATGCAAAGGGTGG - Intergenic
1117854120 14:60009922-60009944 GGTCATGCTAATGCAAGAGGCGG + Intronic
1118533484 14:66732326-66732348 GGGTACGCTGATGCAATGGGTGG - Intronic
1118963979 14:70562164-70562186 GGGCATGCTGATGCAAGGGATGG - Intergenic
1119934064 14:78574480-78574502 GGGCATGCTGATGCAAGAGGTGG - Intronic
1119963164 14:78882460-78882482 GGGCATGCTGATGCAAGAGGTGG - Intronic
1120257826 14:82142054-82142076 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1120389564 14:83888592-83888614 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1120405003 14:84083821-84083843 GGGCATGCTGATGCAAAGGCTGG + Intergenic
1120407175 14:84104098-84104120 GGGCACACTTTTGCAAAGGGTGG - Intergenic
1120707707 14:87761601-87761623 GGTCATGCTGATGCAAAGGGTGG - Intergenic
1120953909 14:90064662-90064684 GGGCAGGCTTACGCAGACGGAGG - Intronic
1121166581 14:91807456-91807478 GGTCATGCTAATGCAAGAGGTGG - Intronic
1121237877 14:92406199-92406221 GGGCATACTAATGCAAGGGGTGG + Intronic
1122765427 14:104066257-104066279 GGCCATACTGATGCAAAGGGTGG + Intergenic
1123128190 14:105964774-105964796 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123408713 15:20040930-20040952 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123518044 15:21047640-21047662 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1124066341 15:26347428-26347450 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1125225300 15:37389290-37389312 GAGCATGCTGATGCAAAGGGTGG + Intergenic
1125336798 15:38634809-38634831 GGGGAGGCCAATAAAAAGGGAGG + Intergenic
1125806528 15:42497995-42498017 GGGCACGCTGATGCCAAGGGTGG + Intronic
1126273010 15:46844520-46844542 GGGCACGCCAATGCAAGAGGTGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127350672 15:58148896-58148918 GGGCAGGCTCATAAAAAGAGAGG - Intronic
1127491840 15:59472384-59472406 GAGCAGGCTAATTCAAAGACTGG + Intronic
1128177019 15:65565116-65565138 GGTCACGCTGATGCAAAAGGTGG + Intronic
1128814053 15:70592705-70592727 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1129242971 15:74262404-74262426 GGGCAGGGTGAGTCAAAGGGAGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131700869 15:94934382-94934404 GGGCAGGCTGATGTAAGGGGTGG + Intergenic
1132470669 16:101177-101199 GGGCAGGCCCATTCACAGGGAGG - Intronic
1133045102 16:3083569-3083591 GGGCTCGCTGATGCAAGGGGTGG + Intergenic
1135226143 16:20659927-20659949 AGGCAGGACAATGCAAAGCGGGG - Intronic
1135918977 16:26631442-26631464 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1137778623 16:51077746-51077768 GGGCACACTGATGCAAGGGGTGG + Intergenic
1138198415 16:55071392-55071414 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1138859917 16:60743934-60743956 GGTCAGGCTGATGCAAGAGGTGG + Intergenic
1138997696 16:62474656-62474678 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1139041380 16:63002491-63002513 GGGCATGCTGATGCAAGTGGTGG - Intergenic
1139303805 16:65966540-65966562 AGGAAGGCTTATGCAAAGGGTGG - Intergenic
1139449117 16:67016207-67016229 TGGGAGGCTGATGGAAAGGGAGG + Intergenic
1140936371 16:79674307-79674329 AGGCAGGGTAATGCAATGTGTGG - Intergenic
1141164461 16:81651242-81651264 GGGCAGGCAGCTGCAAAGGCGGG + Intronic
1141665010 16:85461492-85461514 GGGCAGGCCCACGCAAGGGGGGG + Intergenic
1141801937 16:86315663-86315685 GGGCAGGCGACTGTAAGGGGTGG + Intergenic
1142205410 16:88780442-88780464 AGGCAGGCTAAGGCAGAGAGGGG + Intronic
1144225306 17:13139324-13139346 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1144307700 17:13984095-13984117 AGGCAGGCTCAGGCAGAGGGAGG + Intergenic
1144777621 17:17792742-17792764 GGGGAGGCTCAGGCGAAGGGGGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146451871 17:32981233-32981255 GGACAGGCTGATGCAAGAGGTGG + Intronic
1147637358 17:41972246-41972268 GGGCAGGTGAATGCACAGGCTGG - Intronic
1149081938 17:52668035-52668057 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1149140645 17:53428837-53428859 GGGCACACTAGTGCAAAGGGTGG - Intergenic
1149237247 17:54607002-54607024 GGGCAGGGTAAGGATAAGGGTGG - Intergenic
1149570615 17:57669806-57669828 GGGGAGGCAAATGCAATGGAGGG - Intronic
1150346870 17:64411335-64411357 GGGCAAGCATATGCAATGGGTGG + Intronic
1150515788 17:65808088-65808110 TGGCATGCTGATGCAAGGGGTGG - Intronic
1150740466 17:67775355-67775377 GGGTAGGACAACGCAAAGGGTGG + Intergenic
1151041101 17:70861658-70861680 GGGCACAATGATGCAAAGGGTGG - Intergenic
1151086563 17:71387645-71387667 GGAAATGCTAATGCAAAGGGTGG + Intergenic
1153506411 18:5803826-5803848 GGGCATGCTGATGCAAGGAGTGG - Intergenic
1153685218 18:7538430-7538452 GGGCATGCTGAAGCAAGGGGTGG + Intergenic
1154940783 18:21111332-21111354 GGAAAGGCGAAAGCAAAGGGCGG + Exonic
1156122621 18:33863610-33863632 GGGCATGCTGATGCACAGGGTGG + Intronic
1156151533 18:34249570-34249592 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1156169300 18:34463078-34463100 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1156322396 18:36038753-36038775 GGGCACACTGATGCAAGGGGTGG - Intronic
1157813100 18:50711616-50711638 GGGCATGCCCATGCACAGGGTGG - Intronic
1157843013 18:50977007-50977029 GGGCATGCTGATGCAAGAGGTGG + Intronic
1157941173 18:51930403-51930425 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1158092129 18:53727116-53727138 GGCCACACTGATGCAAAGGGTGG + Intergenic
1158129796 18:54139941-54139963 GGGCACACTGATGCAATGGGTGG - Intergenic
1158864571 18:61625787-61625809 AGGCAGGATAATGCAAAGCGGGG - Intergenic
1159555570 18:69941459-69941481 GGGCATGCTGATGCAAGAGGTGG - Intronic
1159640706 18:70859896-70859918 GGTCATGCCAATGCAAAAGGTGG - Intergenic
1160466734 18:79083702-79083724 GGGCAAGCTGAAGCAAAGTGGGG - Intronic
1161088097 19:2344264-2344286 GGGCAGGGTGATGCGATGGGGGG - Intronic
1162002814 19:7758112-7758134 GGGCACGCTGATGCAAGAGGTGG - Intergenic
1164210163 19:23091572-23091594 GGTCACGCTGATGCAAAAGGTGG - Intronic
1167403545 19:49288965-49288987 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1168516463 19:57013547-57013569 GGGCACACTCATGCAAGGGGTGG - Intergenic
925473954 2:4192300-4192322 GGGCATGCTGATGCAAGAGGTGG + Intergenic
925489387 2:4375285-4375307 AAGCAGGCTGATGCAAGGGGTGG + Intergenic
926067808 2:9858303-9858325 AGGCATGCTGATGCAAGGGGTGG + Intronic
926598315 2:14814414-14814436 GGGCATGCTGATGCAAAGGGTGG - Intergenic
926653331 2:15370610-15370632 GGGCACACTGATGCAAAGGGTGG - Intronic
927100376 2:19783450-19783472 GGTCACGCTGATGCAAAAGGTGG - Intergenic
927302895 2:21536277-21536299 GGGCATGCTGATGCAAGAGGTGG - Intergenic
927329191 2:21842125-21842147 GGGCATGCTAATGCAAGAGGTGG - Intergenic
927400689 2:22706999-22707021 GGTCACGCTGATGCAAAAGGTGG + Intergenic
928731529 2:34237944-34237966 GGTCAGGCTAATGCAACAGATGG - Intergenic
929391315 2:41471885-41471907 GGGCATACTGATGCAAGGGGTGG - Intergenic
930230188 2:48835363-48835385 GGTCATGCTGATGCAAAAGGTGG - Intergenic
930299266 2:49594404-49594426 GGGCATGCCGATGCAAAGGGTGG - Intergenic
930560036 2:52949710-52949732 GGTCATGCTGATGCAAAAGGTGG + Intergenic
930660191 2:54045452-54045474 GAGCAGGCTAATTAAAAGAGAGG + Intronic
930666456 2:54103884-54103906 TGGCCGGCTAGGGCAAAGGGTGG - Intronic
931154174 2:59608574-59608596 GGGCATGCTGATGCAAGGGGTGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932060750 2:68495451-68495473 GGGCACACTGATGCCAAGGGTGG + Intronic
933070960 2:77857475-77857497 GGGCAAGCTAATGCAAGAGATGG - Intergenic
934015837 2:87881069-87881091 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934015842 2:87881090-87881112 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934015847 2:87881111-87881133 GGGCACACTAGTGCAAGGGGTGG + Intergenic
935931614 2:108133011-108133033 GGGCACACTGCTGCAAAGGGTGG + Intergenic
936014454 2:108947214-108947236 GGGCATGCTGATGCAAGGGGTGG + Intronic
936753769 2:115678833-115678855 GGGCATGCTGATGCAAGAGGTGG - Intronic
936915783 2:117637863-117637885 GGTCACGCTGATGCAAAAGGTGG - Intergenic
937427719 2:121813830-121813852 GGTCACGCTTATGCAAAAGGTGG - Intergenic
939023574 2:136985883-136985905 GGGCACGCTGATGCAAGGAGTGG - Intronic
939361302 2:141175891-141175913 GGGCATGCTGATACAAGGGGTGG - Intronic
939445926 2:142310214-142310236 GGGCACACTGATGCAAAGGGTGG + Intergenic
939782960 2:146472989-146473011 GGGCATGCCGATGCAAGGGGTGG - Intergenic
939784585 2:146494125-146494147 GGGCACACTGATGCAAAGGGTGG + Intergenic
939808878 2:146807783-146807805 GGGCAGGGGAATACCAAGGGAGG + Intergenic
939852999 2:147321808-147321830 GGGCATGCTGATGCAAGAGGTGG - Intergenic
940387080 2:153085966-153085988 GGGCATGCTGATGCAAGAGGCGG - Intergenic
940729755 2:157375428-157375450 GGGCACTTTGATGCAAAGGGTGG + Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
941445283 2:165592103-165592125 GGGCATGCTGATGCAAGAGGTGG - Intronic
941803531 2:169687569-169687591 GGTCATGCTGATGCAAAAGGTGG + Intronic
942420031 2:175797755-175797777 GGTCATGCTGATGCAAAAGGTGG - Intergenic
942727583 2:179026803-179026825 GGTCATGCTGATGCAAAAGGTGG - Intronic
942803530 2:179903095-179903117 GGGCAGACTGATGCAAGGGGTGG + Intergenic
943386763 2:187210966-187210988 GGTCATGCTGATGCAAAAGGTGG - Intergenic
943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG + Intergenic
943493363 2:188585165-188585187 GGGCATGCTAATGCAAGGGATGG + Intronic
943686988 2:190829223-190829245 GGACAGGCTAAGGTAAAGAGAGG + Intergenic
943998132 2:194797472-194797494 GGTCACGCTGATGCAAAAGGTGG - Intergenic
944470260 2:200045547-200045569 GGGCATGCTGATGCAAGGGGTGG + Intergenic
944479703 2:200144205-200144227 GGGCACACTGATGCAATGGGTGG + Intergenic
944827931 2:203503951-203503973 GGTCACGCTGATGCAAAAGGTGG + Intronic
945305583 2:208255583-208255605 GCGCTGCCTAATGCAAAGGATGG + Intronic
946108194 2:217390625-217390647 GGTCAGGCTGATGCAAGAGGTGG + Intronic
946317078 2:218923501-218923523 GGGCATGCTGATGCAAGAGGTGG + Intergenic
946371802 2:219285732-219285754 GGGCAGGCTGAGGCAACGAGAGG - Exonic
946575501 2:221071430-221071452 GGTCATGCTGATGCAAGGGGTGG + Intergenic
946988677 2:225303148-225303170 GGTCATGCTGATGCAAAAGGTGG - Intergenic
947951575 2:234152438-234152460 GGTCATGCTGATGCAAGGGGTGG + Intergenic
948292356 2:236835247-236835269 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169990761 20:11500134-11500156 GGGCAAACTAATGTCAAGGGAGG + Intergenic
1170036133 20:11992184-11992206 GGGAAGGCCAAGGCAAATGGGGG - Intergenic
1170102716 20:12720129-12720151 GGGCAGGCAAATGGGGAGGGAGG - Intergenic
1171076994 20:22137601-22137623 GGTCAGGCTTATGCAAGAGGTGG + Intergenic
1171306760 20:24113255-24113277 GGGCAGCCTAATTCAAATCGTGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1172720312 20:36994936-36994958 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1173101296 20:40091335-40091357 GTGCACTCTCATGCAAAGGGTGG + Intergenic
1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG + Intergenic
1174951102 20:55042042-55042064 GGTCAGGCTGATGCAAGAGGCGG - Intergenic
1176519269 21:7812616-7812638 GAACAGGCTAATACAGAGGGTGG - Intergenic
1176688980 21:9881501-9881523 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1176935305 21:14860460-14860482 GGTCATGCTGATGCAAGGGGTGG + Intergenic
1177236071 21:18391507-18391529 CGGCATGCTAATGCAAGGGGTGG + Intronic
1177305998 21:19317003-19317025 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1177328813 21:19629380-19629402 GGGCATGCTGATTCAAAGGGTGG - Intergenic
1177401794 21:20614366-20614388 GGACATGCTGATGCAAGGGGTGG - Intergenic
1177517717 21:22176844-22176866 GGCCACACTAATGCAAGGGGTGG - Intergenic
1177803301 21:25849055-25849077 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1178198853 21:30379708-30379730 GGACACGCTGATGCAAGGGGTGG - Intronic
1178621878 21:34184469-34184491 GGGCAGGCAAATACAGTGGGAGG - Intergenic
1178634156 21:34287945-34287967 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1178653297 21:34442629-34442651 GAACAGGCTAATACAGAGGGTGG - Intergenic
1179065195 21:38018156-38018178 GGTCATGCTGATGCAAAAGGTGG - Intronic
1179453568 21:41482302-41482324 GGGCAGGATAATACATGGGGTGG + Intronic
1181383831 22:22528896-22528918 GGACACACTGATGCAAAGGGTGG + Intergenic
1182330104 22:29545672-29545694 GGTCAAGCTGATGCAAAAGGTGG + Intronic
1182777072 22:32839066-32839088 GTGCAGGCAGATGCACAGGGAGG + Intronic
1182816875 22:33172031-33172053 GGGCAGGCTGATGCAAGAGGTGG - Intronic
949230370 3:1743707-1743729 GGGCATGCTAATTCAAGAGGTGG + Intergenic
949770292 3:7570535-7570557 GGTCATGCTGATGCAAAAGGTGG + Intronic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
952221330 3:31326988-31327010 GGGCACACTGATGCAAGGGGTGG + Intergenic
952734975 3:36680603-36680625 GGGCACACTGATGCAAGGGGTGG + Intergenic
952739775 3:36724067-36724089 GGTCACGCTAATGCAAGAGGTGG - Intronic
953338603 3:42115312-42115334 GGGCAGGGCAAAGGAAAGGGAGG - Intronic
954021921 3:47749793-47749815 GGGCAGGCAAATAAAAAAGGTGG + Intronic
954693951 3:52410411-52410433 GGGCAGGCTAGGGGAAAAGGCGG + Intergenic
956503323 3:69910600-69910622 GGTCATGCTGATGCAAAAGGTGG - Intronic
956671581 3:71696494-71696516 GAGGAGAGTAATGCAAAGGGTGG - Exonic
956947024 3:74234706-74234728 GGTCAGGCTAATGCAAGACGTGG + Intergenic
957260564 3:77896798-77896820 GGTCATGCTGATGCAAGGGGTGG + Intergenic
957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG + Intergenic
957477064 3:80739097-80739119 GGGCATGCTGATGCAAAGGGTGG + Intergenic
957524192 3:81358544-81358566 GGCCACACTGATGCAAAGGGTGG - Intergenic
957609536 3:82449360-82449382 GGGCATGCTGATGCAAGGGGTGG - Intergenic
957978264 3:87474668-87474690 GGGCATGCTGATGCAAGAGGTGG - Intergenic
958006095 3:87813231-87813253 GGGCACGCTGATGCAAGGGATGG - Intergenic
958083776 3:88780298-88780320 GGGCACACTAATGCAAGAGGTGG + Intergenic
958146590 3:89631966-89631988 GGTCATGCTGATGCAAAAGGTGG - Intergenic
958469448 3:94498978-94499000 GGGCACACTGATGCAAAGGGTGG - Intergenic
958474987 3:94569180-94569202 GGGCATGCTAATGCAAGGGGTGG - Intergenic
958475012 3:94569328-94569350 GGGCACACTAATGCAAGAGGTGG - Intergenic
958650016 3:96926737-96926759 GGACATGCTGATGCAAGGGGTGG + Intronic
958685365 3:97386508-97386530 GGGCACACTGATGCAAAAGGTGG + Intronic
959214744 3:103437321-103437343 GGGCACACTGATGCAAAGGGTGG + Intergenic
959507462 3:107171704-107171726 GGGCATGCTGATGCAAGGGATGG - Intergenic
959507983 3:107176596-107176618 GGGCACACTGATGCAAGGGGTGG - Intergenic
959695617 3:109246202-109246224 GGTCACGCTAATGCAAGAGGTGG + Intergenic
959777714 3:110188429-110188451 GGGCATGCTGATGCAAAGGGTGG + Intergenic
959788461 3:110329318-110329340 GGGCACGCTGATGCAAGGGGTGG - Intergenic
959900969 3:111661692-111661714 GGTCACACTGATGCAAAGGGTGG + Intronic
960478764 3:118162749-118162771 GGGCAAGCCAAAGCAGAGGGGGG + Intergenic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
960542020 3:118871747-118871769 GGGCACACTAATGCAAGGGGTGG - Intergenic
962339438 3:134569533-134569555 GGTCACGCTGATGCAAAAGGTGG + Intronic
963494788 3:146045349-146045371 GGGCATGCTTATGTAAGGGGTGG + Intergenic
963777251 3:149451930-149451952 GGGCACTCTCATGCAAATGGTGG + Intergenic
963878263 3:150500868-150500890 GGGCATGCTGATGCAAGAGGTGG + Intergenic
963996525 3:151716575-151716597 GGGCATGCTGATGCAAGGGATGG + Intergenic
964026387 3:152079673-152079695 AGGCATGCTGATGCAAGGGGTGG + Intergenic
964267876 3:154920948-154920970 GGGCATGCTGATTCAAGGGGTGG + Intergenic
964853438 3:161119434-161119456 GGGCATGCTGATGCAAGAGGTGG - Intronic
964933952 3:162059241-162059263 GTGCACGCTGATGCAAGGGGTGG + Intergenic
964974923 3:162606589-162606611 GGGCATGCTGATGTAAGGGGTGG - Intergenic
965066693 3:163858423-163858445 GGGCATGCTGATGCAAGAGGTGG - Intergenic
965305484 3:167058968-167058990 GGGCATGCTCATGTAAATGGTGG + Intergenic
965349693 3:167597671-167597693 GGGCATGCTAAAGCAAGGGGTGG - Intronic
966346837 3:178989935-178989957 TGGCAGGCTGATGCAAAGGGTGG + Intergenic
966902430 3:184496407-184496429 GGGCAGGCTCATGCAATTGCTGG - Intronic
967567461 3:190988835-190988857 GGGCATGCTGATGCAAAGGGTGG - Intergenic
968557169 4:1251448-1251470 GGGCAGGCCCAGGCACAGGGAGG - Intergenic
968695789 4:2025717-2025739 GGGCATGCTGATGCAAGGGGTGG + Intronic
968892801 4:3380232-3380254 GGGCATGCTGATGCAAGAGGTGG + Intronic
969103680 4:4789059-4789081 GGGCATGCTGATGCAAGAGGTGG - Intergenic
969121866 4:4916786-4916808 GGTCATGCTGATGCAAAAGGTGG + Intergenic
969869617 4:10096486-10096508 GGGCAGGTGAAAGCATAGGGAGG - Intronic
970047772 4:11875718-11875740 GGGCATGCTGATGCAAGGGGTGG + Intergenic
970057727 4:11994224-11994246 GGGCATGCTGATGCAAGAGGTGG - Intergenic
970659156 4:18264813-18264835 GGGCCTGCTGATGCAAGGGGTGG + Intergenic
970756914 4:19437708-19437730 GGGCACGCTGATGCAAGAGGTGG - Intergenic
971111650 4:23592182-23592204 GGTCATGCTGATGCAAAAGGTGG - Intergenic
971119706 4:23689851-23689873 GGGCATGCTGATGCAAGAGGTGG - Intergenic
971499185 4:27300308-27300330 GGTCACGCTGATGCAAGGGGTGG + Intergenic
971840998 4:31851561-31851583 GGGCAAGCTGATGCAAGAGGTGG - Intergenic
971892678 4:32544792-32544814 GGGCATGCTGATGCAACAGGTGG - Intergenic
971943548 4:33245628-33245650 GGGCATGCTGATGCAAGGGGTGG + Intergenic
972051621 4:34742707-34742729 GGTCACGTTGATGCAAAGGGTGG + Intergenic
972087880 4:35242236-35242258 GGTCATGCTGATGCAAAAGGAGG - Intergenic
972756886 4:42057009-42057031 GGTCACGCTGATGCAAAAGGTGG + Intronic
972844353 4:42970107-42970129 GGGTATGCTAATGCAAGGGGTGG + Intronic
972847216 4:43004590-43004612 GGGCACACTGATGCAAAGGGTGG - Intronic
972880509 4:43417095-43417117 GGGCATGCTGATACAAAGGGTGG + Intergenic
972894467 4:43602570-43602592 GGGCATGCTGATGAAAGGGGTGG - Intergenic
972897730 4:43644288-43644310 GGGCATGCTGGTGCAAAGTGTGG + Intergenic
972988880 4:44799101-44799123 AGCCATGCTGATGCAAAGGGTGG - Intergenic
973718367 4:53700071-53700093 GGTCATGCTAATTCAAAAGGTGG + Intronic
974177709 4:58345296-58345318 GGGCACACTGATGCAAAAGGTGG - Intergenic
974457456 4:62146083-62146105 TGGCACGTTAATGCAAGGGGTGG - Intergenic
974480624 4:62438256-62438278 GGTCACGCTGATGCAAATGGTGG + Intergenic
974666483 4:64969185-64969207 GGACATGCTTATGCAAAGGGTGG + Intergenic
974867424 4:67597639-67597661 GGGCACACTGATGCAAGGGGTGG - Intronic
974931506 4:68365823-68365845 GGTCATGCTGATGCAAGGGGTGG - Intergenic
975456551 4:74597635-74597657 GGTCACGCTAATGCAAGAGGTGG - Intergenic
975627057 4:76360542-76360564 GGGCATGCTGATGTAAGGGGTGG - Intronic
975878193 4:78868802-78868824 GGTCATGCTGATGCAAAAGGTGG + Intronic
976070170 4:81231763-81231785 GGGTATGCTGATGCAACGGGTGG - Intergenic
976142034 4:82002741-82002763 GGCCACACTAATGCAAGGGGTGG - Intronic
977365912 4:96068062-96068084 GGTCACACTAATGCAAAAGGTGG + Intergenic
977368315 4:96101723-96101745 GGGCATGCTGATACAAGGGGTGG - Intergenic
977396624 4:96479074-96479096 GGGAATGCTGATGCAAGGGGTGG - Intergenic
977722081 4:100250835-100250857 GGGCATGCTGAGGCAAGGGGTGG + Intergenic
978201653 4:106029344-106029366 GGACATGCTGATGCAAAAGGTGG - Intergenic
978256030 4:106693857-106693879 GGGCATGCTGATGCAAGAGGTGG - Intergenic
978344928 4:107756864-107756886 GGCCACACTAATGCAAAGGGTGG - Intergenic
978696276 4:111584154-111584176 GGGAATGCTGATGCAAGGGGTGG + Intergenic
978809811 4:112837649-112837671 GGGAATGCTGATGCAAGGGGTGG - Intronic
979063607 4:116098729-116098751 GGTCACGCTAATGCAAGAGGTGG - Intergenic
979362673 4:119783297-119783319 GGGCATGCTGATGCAAAGGGTGG + Intergenic
979702993 4:123689010-123689032 GGGCACACTGATGCAAGGGGTGG + Intergenic
979805070 4:124961021-124961043 GGGCATGCTGATGCAAAGGGTGG + Intergenic
979948130 4:126860015-126860037 GGGCATGCTGATGAAAGGGGTGG + Intergenic
979969330 4:127114660-127114682 GGGCACACTGATGCAAGGGGTGG - Intergenic
980084406 4:128376934-128376956 GGGCATGCTGATGCAAGGGTGGG + Intergenic
980293149 4:130870942-130870964 GGTCATGCTGATGCAAAGGGTGG - Intergenic
980335619 4:131469324-131469346 GGTCACGCTAATGCAAGAGGTGG - Intergenic
980352365 4:131699319-131699341 GGTCATGCTAATGCAAGAGGTGG + Intergenic
980707558 4:136519712-136519734 GGGCATGCTGATGCAAGAGGTGG + Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
981407147 4:144385179-144385201 GGTCAGGCTGATGCAAGAGGTGG + Intergenic
983132787 4:164042957-164042979 GGGCATGCTAATGCAAGGAGGGG + Intronic
983657119 4:170094162-170094184 GGGCAGGCTAATGGAATGCAGGG + Intergenic
983723776 4:170893194-170893216 GGTCATGCTGATGCAAAAGGTGG + Intergenic
984436659 4:179718571-179718593 GGGCACACTGATGCAAAGGGTGG + Intergenic
984571862 4:181404404-181404426 AGGCATGCTGATGCAAAGGATGG + Intergenic
985076841 4:186224447-186224469 GGGCATGCTGATGCAAGGTGTGG - Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985368534 4:189260432-189260454 GGGCATGCTGATGCAAGGGGTGG + Intergenic
985474184 5:68921-68943 GGGCATGCTGATGCAAGAGGTGG - Intergenic
986258651 5:6123577-6123599 GGTCATGCTGATGCAAAAGGTGG + Intergenic
986601612 5:9478517-9478539 GGGCACACTGATGCAAGGGGTGG - Intronic
986975458 5:13388352-13388374 GGACATGCTGATGCAAGGGGTGG - Intergenic
987201665 5:15583644-15583666 GGGCATGCTTATGCAAGGGGTGG + Intronic
987265942 5:16255356-16255378 GGGCATGCTGATGCAAGAGGTGG - Intergenic
987512418 5:18856837-18856859 GGTCATGCTGATGCAAGGGGTGG - Intergenic
987744148 5:21948334-21948356 GGGCATGTTAATGCAAGGGGTGG - Intronic
988076853 5:26364615-26364637 GGTTATGCTGATGCAAAGGGTGG - Intergenic
988204321 5:28115027-28115049 GGTCATGCTGATGCAAAAGGTGG + Intergenic
988396058 5:30698997-30699019 GGGCATGCTGATGCAAGAGGTGG - Intergenic
988925167 5:35982387-35982409 GGACATGCTGATGCAAGGGGTGG - Intronic
989399346 5:40992613-40992635 GGGCATGCTGATGCAAGAGGTGG + Intergenic
989520217 5:42392587-42392609 GGGCACACTAATGAAAGGGGTGG + Intergenic
989753474 5:44923036-44923058 GGTCATGCTGATGCAAAAGGTGG - Intergenic
989787008 5:45344694-45344716 GGGCATGCTGATGCAAGAGGTGG + Intronic
990125987 5:52518373-52518395 GGTCGGGCTGATGCAAAAGGTGG - Intergenic
990597294 5:57324392-57324414 GGGCAGGACACTGGAAAGGGAGG - Intergenic
990789054 5:59455792-59455814 GGTCATGTTAACGCAAAGGGTGG - Intronic
991222990 5:64237241-64237263 GGGCATGCTGATGCAATGAGTGG - Intronic
991535983 5:67669663-67669685 GGTCATGCTGATGCAAAGGGTGG - Intergenic
991764352 5:69958471-69958493 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991782976 5:70159676-70159698 GGGCATGTTAATGCAAGGGGTGG + Intergenic
991843584 5:70833543-70833565 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991875417 5:71160003-71160025 GGGCATGTTAATGCAAGAGGTGG + Intergenic
992591599 5:78301325-78301347 GGACATGCTGATGCAAGGGGTGG - Intergenic
992969559 5:82042794-82042816 GGGCATGCTGATGCAAGGGGTGG + Intronic
993253082 5:85553348-85553370 GGGCATGCTGATGCAAGGAGTGG + Intergenic
993263675 5:85694296-85694318 GGGCATGCCAATTCAAAGGGTGG + Intergenic
993390916 5:87319090-87319112 GGGCACGCTGATGCAAGGGGTGG + Intronic
993517589 5:88857116-88857138 GGTCATGCTGATGCAAAAGGTGG - Intronic
993761242 5:91799944-91799966 GGTCATGCTAATGCAAGAGGTGG + Intergenic
994549208 5:101209008-101209030 GGGCACACTAGTGCAAGGGGTGG - Intergenic
994808316 5:104479746-104479768 GGGCATGCTGATGCAAGAGGTGG - Intergenic
994878839 5:105460621-105460643 GGGCACACTGATGCAAAGGGTGG + Intergenic
995690889 5:114824965-114824987 GGACAGACTAATGCAAGAGGTGG + Intergenic
995723774 5:115165055-115165077 GGGTACGCTGATCCAAAGGGTGG + Intronic
996122839 5:119691100-119691122 GGGCACGCTGATGCAAGAGGTGG + Intergenic
996530422 5:124521884-124521906 GGGGAGGCTCAGGCATAGGGGGG - Intergenic
996605176 5:125313235-125313257 GGGCATGCTGATGCAAGGGATGG + Intergenic
997669430 5:135658370-135658392 GGGCACACTGATGCTAAGGGTGG + Intergenic
998160739 5:139811446-139811468 GGGGAGGCTGATGCAGAGGGAGG + Intronic
999425613 5:151485554-151485576 GGGCAAGGAAATGCAGAGGGAGG - Intronic
999504354 5:152179793-152179815 GGGCATGCCGATGCAAGGGGTGG + Intergenic
1000304747 5:159984986-159985008 GGGCAGACCATTGCAAAGTGTGG - Intergenic
1000522895 5:162319343-162319365 TGTCATGCTGATGCAAAGGGTGG - Intergenic
1000575470 5:162970198-162970220 GGGCATGTTAATGCAAGGGATGG - Intergenic
1002283113 5:178144778-178144800 TGGGAGGCCAAAGCAAAGGGCGG + Intronic
1002474001 5:179453695-179453717 GGGGATGCTGCTGCAAAGGGCGG - Intergenic
1003229977 6:4243233-4243255 GGGCACACTGATGCAAGGGGTGG + Intergenic
1003274450 6:4637242-4637264 GGGCAGGAGAATGGAAAGGGTGG + Intergenic
1005137876 6:22591910-22591932 AGGAAGGCTAATTCTAAGGGTGG + Intergenic
1005417171 6:25612361-25612383 GGGCATGCTAGTCCAAAGGGAGG - Intronic
1006416253 6:33905839-33905861 GGGAAGGCTAAGGGAAAGGCAGG - Intergenic
1006693318 6:35909223-35909245 GGGCATGCCGATGCAAGGGGTGG - Intronic
1007335187 6:41150579-41150601 GGGTAGGGCAATGCAATGGGAGG - Intronic
1007397463 6:41585921-41585943 GGGCAGGCTGAGGTAAGGGGAGG - Intronic
1008260943 6:49366190-49366212 GGGAATGCTGATGCAAAAGGTGG + Intergenic
1008631393 6:53365863-53365885 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1009348525 6:62646655-62646677 GGCCATGCTGATGCAAAAGGTGG - Intergenic
1009396680 6:63207207-63207229 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG + Intergenic
1010539091 6:77069344-77069366 GGGCATGCTGATGCAAGGGTTGG + Intergenic
1010643045 6:78354230-78354252 GGCCACACTAATGCAAGGGGTGG + Intergenic
1010810352 6:80292947-80292969 GGTCAGGCTAATGCAAGAGGTGG + Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1011169399 6:84489300-84489322 GGGCATGCTAATGCAAGAGGTGG + Intergenic
1011288000 6:85745199-85745221 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1011294027 6:85807919-85807941 GGGCACACTGATGCAAGGGGTGG + Intergenic
1012485953 6:99722747-99722769 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1012617316 6:101293074-101293096 GGGCACACTAATGCAAGGGGTGG + Intergenic
1012700463 6:102451034-102451056 GGTCAAGCTGATGCAAAAGGTGG + Intergenic
1012751453 6:103168466-103168488 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1013077086 6:106781102-106781124 GGGCATGCTGATGCAAGTGGTGG - Intergenic
1013149120 6:107426685-107426707 GGTCACGCTGATGCAAAGGGTGG - Intronic
1014449438 6:121565884-121565906 GGTCATGCTGATGCAAGGGGTGG - Intergenic
1014714625 6:124849500-124849522 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1015045125 6:128767837-128767859 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1016106537 6:140170913-140170935 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1016264265 6:142213300-142213322 GGTCATGCCAATGCAAGGGGTGG + Intronic
1016291728 6:142535010-142535032 GGGCACACTGATGCAAGGGGTGG - Intergenic
1016513015 6:144864352-144864374 GGGCACACTGATGCAAGGGGTGG - Intergenic
1016575446 6:145565170-145565192 GGGCATGCTAATAGAAAGGATGG - Intronic
1016613804 6:146024413-146024435 GGGAATGCTGATGCAAGGGGTGG - Intergenic
1016632616 6:146249902-146249924 GGACACACTAATGCAAGGGGTGG - Intronic
1016785956 6:148010980-148011002 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1016806048 6:148213009-148213031 GGGCAGGAGAATGTAAAAGGAGG - Intergenic
1017133706 6:151129913-151129935 GGTCATGCTGATGCAAAGGTGGG - Intergenic
1017815421 6:158012732-158012754 AGGCAGGCTGATGGAAAAGGTGG + Intronic
1017860487 6:158393192-158393214 GGGCATGCTGATGCAAGAGGTGG + Intronic
1018041068 6:159922521-159922543 GGCCATGCTGATGCAAAAGGTGG - Intergenic
1018527529 6:164729284-164729306 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1018534607 6:164807066-164807088 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1018592594 6:165443378-165443400 GTGCATGCTGATGCAAGGGGTGG + Intronic
1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG + Intergenic
1019039419 6:169091190-169091212 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1020611235 7:10400934-10400956 GGTCAGGCTGATGCAAGAGGTGG + Intergenic
1020693903 7:11391889-11391911 GGGCAAGCTGAAGCAAAGTGGGG - Intronic
1020927120 7:14343599-14343621 GGGTAGGATAAAGTAAAGGGAGG + Intronic
1021096394 7:16540183-16540205 GGGCATGCTGATGCAAAGGGTGG - Intronic
1021617763 7:22520314-22520336 GGGCACGCTGATGCAAGAGGTGG - Intronic
1022705937 7:32802157-32802179 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1022852698 7:34281897-34281919 GGACATGCTGATGCAAAGGGTGG + Intergenic
1022927352 7:35069790-35069812 GGGCACGCTAATGCAAGGGGTGG - Intergenic
1022959814 7:35415729-35415751 GGCCAGGGTAATCCAGAGGGAGG + Intergenic
1022964228 7:35457791-35457813 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1023406955 7:39843467-39843489 GGGCATGCTGATGCAAGGGGTGG - Intergenic
1024021371 7:45373834-45373856 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1024424694 7:49212282-49212304 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1024490250 7:49974360-49974382 GGGCAGGATAATTAAAAGGCAGG + Intronic
1024854076 7:53756307-53756329 AGGCAGGCAATTCCAAAGGGTGG - Intergenic
1025163076 7:56683001-56683023 GGCCATGCTGATGCAAGGGGTGG + Intergenic
1025221566 7:57114833-57114855 GGCCATGCTGATGCAATGGGTGG + Intergenic
1025267399 7:57474959-57474981 GGCCACGCTGATGCAAAGGGTGG - Intergenic
1025632349 7:63286501-63286523 GGCCATGCTGATGCAATGGGTGG + Intergenic
1025650213 7:63459731-63459753 GGCCATGCTGATGCAATGGGTGG - Intergenic
1025721621 7:64020825-64020847 GGCCATGCTGATGCAAGGGGTGG - Intergenic
1025743645 7:64223623-64223645 GGGCATGCTGATGCAAGGGGTGG - Intronic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1026901523 7:74040023-74040045 GGGCAGGTGAGTGCAAAGGAAGG + Intronic
1027666544 7:81047592-81047614 GGGCACACTGATGCAACGGGTGG - Intergenic
1027958976 7:84919531-84919553 GGTCACACTAATGCAAAAGGTGG + Intergenic
1028008078 7:85603889-85603911 GGGAAGGGTAATGGAAAGGTGGG - Intergenic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028066500 7:86391489-86391511 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1028374916 7:90135794-90135816 GGGCATGCTGATGCAAGGCGTGG + Intergenic
1028438248 7:90829888-90829910 GGGCACTCTCATGCAAAGTGTGG + Intronic
1028844213 7:95461319-95461341 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1029812116 7:103059802-103059824 GAGCAAGATAATGCAAAGGGTGG + Intronic
1030357256 7:108556586-108556608 AGGCATGCTGATGCAAGGGGTGG + Intronic
1030754623 7:113272788-113272810 GGGCACACTGATGCAAGGGGTGG + Intergenic
1031035635 7:116785108-116785130 GGGCACGCTGATGCAAGGGATGG + Intronic
1031175111 7:118339513-118339535 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1031283981 7:119841559-119841581 GGGCACACTGATGCAAGGGGTGG - Intergenic
1031315949 7:120257488-120257510 GGGCATGATGATGCAAGGGGTGG - Intergenic
1031435558 7:121728328-121728350 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1031576085 7:123417492-123417514 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1031914060 7:127545969-127545991 GGACATGCTGATTCAAAGGGTGG + Intergenic
1032484992 7:132278935-132278957 GGAGAGGCCACTGCAAAGGGAGG + Intronic
1033120030 7:138659546-138659568 GGGCAGGACAACTCAAAGGGTGG - Intronic
1033482974 7:141760189-141760211 GGGCATGCTGATGCAAGAGGTGG + Intronic
1033716840 7:144011047-144011069 GGGCATGCTTATGCAACAGGTGG - Intergenic
1034011163 7:147531067-147531089 GGTCACGCTGATGCAAGGGGTGG + Intronic
1034209236 7:149348642-149348664 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1034689233 7:153000645-153000667 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1035120684 7:156564216-156564238 GGGTATGCTGATGCAAGGGGTGG + Intergenic
1035547978 8:498312-498334 GGGCATGCTGATGCAAGGGGTGG - Intronic
1037590258 8:20305916-20305938 GGGCAGGTTTATACAAAGGTGGG - Intergenic
1038308603 8:26426851-26426873 AGGCAGGCAGAGGCAAAGGGAGG + Intronic
1039309295 8:36298077-36298099 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1040078011 8:43259881-43259903 GGGCATGCTGATGCAAGGAGTGG + Intergenic
1041902433 8:62996830-62996852 CGGTACGCTGATGCAAAGGGTGG + Intronic
1042161908 8:65905108-65905130 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1042982062 8:74540751-74540773 GGGCACACTGATGCAAGGGGTGG + Intergenic
1043205003 8:77426686-77426708 GGTCACGCTGATGCAAGGGGTGG - Intergenic
1043779381 8:84312667-84312689 GGGCATGCTGATGCAAAGGGTGG + Intronic
1044851503 8:96433004-96433026 GGGCATGATGATGCAAAGGGTGG - Intergenic
1045050429 8:98319647-98319669 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1045700686 8:104862855-104862877 GGGCATGCTGATGCAAGGGGTGG - Intronic
1045884357 8:107078505-107078527 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1045993663 8:108338941-108338963 GGGCTGGCTGATGCAAGGAGTGG + Intronic
1046668797 8:117035445-117035467 GGGCATGCTGATGCAAGGCGTGG + Intronic
1046880141 8:119298855-119298877 GTTCATGCTAATGCAAAGGATGG + Intergenic
1048043263 8:130750828-130750850 GGGCATGCTGATGCAAAGGGTGG + Intergenic
1048419396 8:134262009-134262031 GGTCACGCTGATGCAAAAGGTGG - Intergenic
1048758698 8:137767463-137767485 AGGCAAGCTGATGCAAAGGGTGG - Intergenic
1048783037 8:138022247-138022269 GGTCATGCTAATGCAAAAGGTGG - Intergenic
1049071627 8:140359733-140359755 AGGCAGGCTAAGGAAATGGGAGG + Intronic
1049347213 8:142145433-142145455 GGGCTGGCCAATGCACAGGTGGG + Intergenic
1050402523 9:5271187-5271209 GGTCACGCTAATGCAAGAGGTGG - Intergenic
1050890491 9:10818932-10818954 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1050894706 9:10872386-10872408 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1050939403 9:11439984-11440006 GGGCACGCTGATGCAAGGGATGG - Intergenic
1050987467 9:12101769-12101791 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1051767386 9:20540099-20540121 GGGCATGCTGATGCAAGGGCTGG + Intronic
1051920756 9:22260663-22260685 GGGCATACTGATGCAAAGGGTGG - Intergenic
1052522279 9:29563289-29563311 GGGCATGCTGACGCAAAGAGTGG - Intergenic
1053125937 9:35580808-35580830 GGGCATACTGATGCAAAAGGTGG - Intergenic
1053780347 9:41600394-41600416 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1054168289 9:61810551-61810573 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1054669240 9:67770267-67770289 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1054797091 9:69312821-69312843 GGGCATGCTGATGCAAAGGTTGG + Intergenic
1055223889 9:73970408-73970430 GGGCATGCTGATGCAACAGGTGG - Intergenic
1055231974 9:74077242-74077264 GGTCATGCCAATGCAAAAGGTGG + Intergenic
1055858761 9:80723818-80723840 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1056634473 9:88320322-88320344 GGCCAGCCCAATGCAAAGGGAGG - Intergenic
1057325650 9:94061233-94061255 GGGAACACTGATGCAAAGGGTGG + Intronic
1057559920 9:96119293-96119315 GGGCAGCCTAATGAGATGGGAGG - Intergenic
1058380502 9:104372162-104372184 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1058413451 9:104760766-104760788 GGTCAGGCTCATGCAAAAGCAGG - Intergenic
1058810077 9:108630774-108630796 GGTCACGCTGATGCAAAGGTGGG - Intergenic
1058813126 9:108660164-108660186 GGGCACACTGATGCAATGGGTGG - Intergenic
1059110691 9:111556217-111556239 GGGCATGCTGATGCAAAGGGTGG + Intronic
1059405522 9:114096569-114096591 GGTCAGCCTCATGCAAAGGCAGG + Intronic
1061198871 9:129124747-129124769 GGGTAGGCCAAAGTAAAGGGAGG - Intronic
1186926159 X:14335516-14335538 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1187603821 X:20861792-20861814 GGCCATGCTAATGCAAGGGGTGG - Intergenic
1187639597 X:21273812-21273834 GGGCTCGCTGATGCAAGGGGTGG + Intergenic
1188115535 X:26238523-26238545 GGGCACGCTGATGCAAGGGGTGG + Intergenic
1188166440 X:26870152-26870174 GGGCACACTGATGCAAGGGGTGG + Intergenic
1188662284 X:32775133-32775155 GGGCAGGCTGATGCAAGGGGTGG + Intronic
1188925888 X:36043606-36043628 AGGCATGCTGATGCAAAGGGTGG + Intronic
1189408210 X:40744735-40744757 GAGCACGCTCATGCAAGGGGTGG + Intergenic
1189431327 X:40950174-40950196 GGGCACACTGATGCAAGGGGTGG + Intergenic
1189553033 X:42113216-42113238 GGGCATACTGATGCAAGGGGTGG + Intergenic
1189637131 X:43023253-43023275 GGTCACGCTCATGCAAGGGGTGG + Intergenic
1190100419 X:47518493-47518515 GGGCAGCCTAGGGCATAGGGTGG - Intergenic
1190387660 X:49898420-49898442 GGACATGCTGATGCAAGGGGGGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190794163 X:53725612-53725634 GGGCACACAGATGCAAAGGGTGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191595864 X:62943702-62943724 GGTCATGCTAATGCAAACAGTGG + Intergenic
1191783952 X:64897457-64897479 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1191802197 X:65093529-65093551 GGGCATGCTGATGTAAGGGGTGG - Intergenic
1193068377 X:77281444-77281466 GTGCATGCTGATGCAAATGGTGG - Intergenic
1193195969 X:78631838-78631860 GGGCACACTGATGCAAAAGGGGG - Intergenic
1193316472 X:80071489-80071511 GGTCATGCTAATGCAAGAGGTGG + Intergenic
1193329707 X:80222663-80222685 AGGCATGCTGATGCAAGGGGTGG - Intergenic
1193330158 X:80226840-80226862 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1193387246 X:80886132-80886154 AGGCATGCTGATGCAAGGGGTGG + Intergenic
1193541789 X:82781734-82781756 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1193724747 X:85025723-85025745 GGGCACACTGCTGCAAAGGGTGG + Intronic
1193777229 X:85657804-85657826 GAGCATGCCAATACAAAGGGTGG - Intergenic
1193850551 X:86531930-86531952 GGGTATGCTGATGCAAGGGGTGG - Intronic
1193911212 X:87309187-87309209 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1193930610 X:87546768-87546790 GGGCACATTGATGCAAAGGGTGG - Intronic
1193972111 X:88067500-88067522 GGCCACACTGATGCAAAGGGTGG - Intergenic
1194043279 X:88970236-88970258 GGGCATACTGATGCAAAAGGTGG + Intergenic
1194107725 X:89792573-89792595 GGGCAGGCTGATGCAAGGGGTGG + Intergenic
1194119175 X:89938961-89938983 GGGCACACTAGTGCAAGGGGTGG + Intergenic
1194435133 X:93860344-93860366 GGGCATTCTGATGCAAGGGGTGG - Intergenic
1194438647 X:93901490-93901512 GGGCATGGTGATGAAAAGGGTGG - Intergenic
1194507139 X:94746296-94746318 GGTCATGCTAATGCAAGAGGTGG - Intergenic
1194548837 X:95272133-95272155 GGCCACACTGATGCAAAGGGTGG + Intergenic
1194841661 X:98751832-98751854 GAGCATGCTGATGCAAAGGGTGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195823619 X:108973117-108973139 GGTCACGCTAATGCAAGAGGTGG - Intergenic
1196169851 X:112575196-112575218 GGTCACGCTGATGCAAAAGGTGG - Intergenic
1196223491 X:113139013-113139035 GGGCACACTGATGCAAGGGGTGG + Intergenic
1196483685 X:116180209-116180231 GGTCACGCTGATGCAAGGGGTGG - Intergenic
1196498616 X:116351238-116351260 GGGCATGCTGATGCAAAGGGTGG - Intergenic
1196579450 X:117361888-117361910 GGTCAGGCTGATGCAAGAGGTGG - Intergenic
1196903467 X:120409581-120409603 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1197439921 X:126475694-126475716 GGGCATACTGATGCAAGGGGTGG + Intergenic
1197581962 X:128294645-128294667 GGGCATGCTGATGCAAGAGGTGG - Intergenic
1197583147 X:128310565-128310587 GGGAATGCTGATGCAAAGGGTGG + Intergenic
1197594321 X:128448788-128448810 GGGCATGCTGATGCAAGAGGTGG + Intergenic
1198497097 X:137203862-137203884 GGGCACACTGATGCAAGGGGTGG + Intergenic
1198569837 X:137942750-137942772 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1199020386 X:142870958-142870980 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1199062524 X:143376046-143376068 AGGCATGCTAATGCAAAGGGTGG + Intergenic
1199070350 X:143468767-143468789 GGGCACGCTGATGCAAGAGGTGG + Intergenic
1199072700 X:143497682-143497704 GGGCAAGCTGATGCAAGAGGTGG + Intergenic
1199119145 X:144030013-144030035 GGGCACACTGGTGCAAAGGGTGG - Intergenic
1199128645 X:144157435-144157457 GGGCACACTAGTGCAAGGGGTGG - Intergenic
1199170691 X:144731731-144731753 GGGCATGCTGATGCAAGGGGTGG + Intergenic
1199198107 X:145056388-145056410 GTGCAGGCTGTTGCAAAGGAAGG - Intergenic
1199220258 X:145309210-145309232 GGTCATGCTGATGCAAAAGGTGG + Intergenic
1199279686 X:145986339-145986361 TGGGAGGCTGAGGCAAAGGGAGG - Intergenic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1199585602 X:149412910-149412932 GGGCACACTAGTGCAAAGAGTGG - Intergenic
1199869849 X:151888482-151888504 GGTCATGCTGATGCAAAAGGTGG - Intergenic
1199931771 X:152530597-152530619 GGGCACGCCGATGCAAGGGGTGG + Intergenic
1200459682 Y:3440358-3440380 GGGCAGGCTGATGCAAGGGGTGG + Intergenic
1200472049 Y:3596520-3596542 GGGCACACTAGTGCAAGGGGTGG + Intergenic