ID: 981182649

View in Genome Browser
Species Human (GRCh38)
Location 4:141763945-141763967
Sequence TACAGCCACTCCCCATCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 2, 1: 0, 2: 2, 3: 22, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981182649_981182652 3 Left 981182649 4:141763945-141763967 CCGAGTGATGGGGAGTGGCTGTA 0: 2
1: 0
2: 2
3: 22
4: 171
Right 981182652 4:141763971-141763993 ACACATGAAGCTGGGATTACAGG No data
981182649_981182654 24 Left 981182649 4:141763945-141763967 CCGAGTGATGGGGAGTGGCTGTA 0: 2
1: 0
2: 2
3: 22
4: 171
Right 981182654 4:141763992-141764014 GGCGTGAGCCACCGAGGCCAAGG No data
981182649_981182651 -5 Left 981182649 4:141763945-141763967 CCGAGTGATGGGGAGTGGCTGTA 0: 2
1: 0
2: 2
3: 22
4: 171
Right 981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG No data
981182649_981182650 -6 Left 981182649 4:141763945-141763967 CCGAGTGATGGGGAGTGGCTGTA 0: 2
1: 0
2: 2
3: 22
4: 171
Right 981182650 4:141763962-141763984 GCTGTAAATACACATGAAGCTGG No data
981182649_981182653 18 Left 981182649 4:141763945-141763967 CCGAGTGATGGGGAGTGGCTGTA 0: 2
1: 0
2: 2
3: 22
4: 171
Right 981182653 4:141763986-141764008 ATTACAGGCGTGAGCCACCGAGG 0: 346
1: 1232
2: 2298
3: 2417
4: 2364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981182649 Original CRISPR TACAGCCACTCCCCATCACT CGG (reversed) Intergenic
901693590 1:10990377-10990399 TACAGCCCCTCCCCCAAACTGGG + Intergenic
902703497 1:18189109-18189131 TGCTGCCACTGCCCATCTCTGGG - Intronic
904020801 1:27463480-27463502 TACAGGCACCCGCCACCACTCGG - Intronic
904647893 1:31982025-31982047 TGCAGCCACACCCCAACACACGG + Intergenic
904818431 1:33222796-33222818 CACAGCCAAACCACATCACTAGG - Intergenic
905873435 1:41417746-41417768 GACAGTCACTCCCCCTCTCTGGG - Intergenic
906557726 1:46727901-46727923 TACAGCAACCCCCCATGACATGG + Intergenic
908549544 1:65194894-65194916 TTCAGCCTCTACCCATTACTTGG + Intronic
911246456 1:95523676-95523698 TACAGCAACACCCCATTTCTTGG - Intergenic
911764828 1:101661732-101661754 TCCAGCCACACTCCATCACCAGG - Intergenic
914844403 1:151273841-151273863 TACAGGCACTCCCAGTCTCTTGG - Intergenic
917503593 1:175608005-175608027 TACAGCCACTGTGCCTCACTAGG + Intronic
919847873 1:201652702-201652724 TACACCCCCTTCCCATCCCTAGG - Intronic
924275674 1:242384316-242384338 TACAGCCACTTCCCCTCACAGGG + Intronic
1063119831 10:3097535-3097557 TACAGGGACTGCCCATCACCAGG - Intronic
1063521755 10:6747749-6747771 CACAGCCAATCCACATCACTGGG - Intergenic
1065460797 10:25961901-25961923 TACAGCCACTGCCCCTCTTTTGG - Intronic
1066509826 10:36083561-36083583 TCAACCCACTCCCCCTCACTAGG - Intergenic
1067803901 10:49380152-49380174 CACAGCCACCCCCCTGCACTGGG - Intronic
1072859708 10:98990454-98990476 TACAGCCACTCCCCATCACTTGG - Intronic
1072925413 10:99612663-99612685 CACAGCCACTCCCCTTCACTGGG - Intronic
1074287302 10:112110293-112110315 CACAGCCAAACCACATCACTGGG - Intergenic
1074416724 10:113273470-113273492 TGCAGCCAGCCCCCATTACTGGG + Intergenic
1074500616 10:114020643-114020665 CACAGCCAAACCACATCACTTGG - Intergenic
1074614520 10:115053931-115053953 CACCCCCACTCTCCATCACTGGG - Intergenic
1076550962 10:131277980-131278002 TTCAGCCACTCCCCAAAACAGGG + Intronic
1077396945 11:2329168-2329190 TCCACCAAGTCCCCATCACTCGG + Intergenic
1077796661 11:5499439-5499461 AACAGCAACTCTACATCACTGGG + Intronic
1078471733 11:11593054-11593076 TACAGGCACCCCCCAACGCTCGG + Intronic
1079491841 11:20997358-20997380 TACAGCCATTCCAGAGCACTGGG + Intronic
1080218873 11:29877106-29877128 TACTGCCACACCACATCTCTAGG + Intergenic
1083552251 11:63598745-63598767 CACAGACACTCCCCAACACCTGG + Intronic
1083598561 11:63932174-63932196 CACAGCCACTCCCAATCTCCAGG - Intergenic
1083840373 11:65301106-65301128 TAAAGCCCCTCCCCATTCCTAGG - Intronic
1085287706 11:75374924-75374946 GACACCCTCTCCCCACCACTAGG - Intergenic
1085457656 11:76674278-76674300 ACCAGCTACTCCCCACCACTGGG - Intergenic
1085760946 11:79241068-79241090 TCAAGCCACTCAGCATCACTGGG - Intronic
1085911251 11:80829496-80829518 TACAACCTTTCCACATCACTTGG + Intergenic
1088532680 11:110827740-110827762 TACTGCCACCCTCGATCACTTGG + Intergenic
1090272015 11:125393446-125393468 TCCAGCCTCTCCCGGTCACTGGG - Intronic
1093160511 12:15741283-15741305 TCCAGCCACCCCCCTCCACTAGG + Intronic
1093650692 12:21642054-21642076 TACATCCACTTCCAATCACGCGG + Exonic
1093880558 12:24399237-24399259 TACAGCGTCTCCCCATACCTGGG + Intergenic
1094667294 12:32533351-32533373 TACAGACATTCTCCCTCACTGGG - Intronic
1095173806 12:39066784-39066806 TACAGCCTCTGCCCATTACTGGG + Intergenic
1096320528 12:50608483-50608505 TACAGCCACGCACCACCACGTGG - Intronic
1098442718 12:70535134-70535156 TACAGGCTCTCCCCTTCACTTGG - Intronic
1100353965 12:93811278-93811300 TACAGCCCCTCCCCAGAACTGGG + Intronic
1104093229 12:125533399-125533421 TACAGCCTCTCCCCTTCCCAGGG + Intronic
1107936497 13:45349780-45349802 TAGCCCCACTCCCCATCAGTAGG + Intergenic
1108866889 13:54934812-54934834 CACAGCCTCTTCCAATCACTGGG - Intergenic
1111400494 13:87727810-87727832 TAAAGTCACTACCCGTCACTTGG - Intergenic
1112292861 13:98160320-98160342 GATAGCCACTCCCCAGCACCAGG - Intronic
1112469757 13:99676732-99676754 TACAGGCATGCCCCACCACTGGG + Intronic
1113402387 13:110005729-110005751 GACAGTCACTCACCAGCACTTGG - Intergenic
1115522534 14:34247186-34247208 TAGAGCCTCTGCTCATCACTTGG - Intronic
1116443837 14:44985630-44985652 TACAGTAGCTCCCCATCACTGGG - Intronic
1116779619 14:49222178-49222200 TACACCAACACCCCATCACTTGG - Intergenic
1119383514 14:74242983-74243005 AACAGCAACTCACCAACACTCGG + Intronic
1120241807 14:81958810-81958832 CACAGCCAAACCACATCACTGGG - Intergenic
1123756296 15:23400035-23400057 AGGACCCACTCCCCATCACTAGG + Intergenic
1124076260 15:26447596-26447618 TACAGCCATACCCTATGACTTGG - Intergenic
1125738840 15:41947297-41947319 GACAGACACTCCACACCACTAGG - Intronic
1126662905 15:51049576-51049598 TAGGGCCATTCCCCATCCCTGGG + Intergenic
1127200783 15:56647670-56647692 TACAGTCACACCACAACACTTGG + Intronic
1130932256 15:88437938-88437960 TACAGACTCTCCCCATTGCTAGG + Intergenic
1131111254 15:89766595-89766617 AACACCCACCCGCCATCACTTGG + Intronic
1132121319 15:99178639-99178661 TACAGACACTGCCCCTCACTAGG + Intronic
1132463443 16:66810-66832 GGCAGCAACTCCACATCACTGGG + Intronic
1132680759 16:1140806-1140828 AAGAGCCACCCCCCAACACTGGG + Intergenic
1133101340 16:3481954-3481976 TAAAGCCACCCACCATCTCTTGG - Intronic
1133899182 16:9957357-9957379 CACAGCCACTCCCTATCTCATGG + Intronic
1134460040 16:14422688-14422710 AGGACCCACTCCCCATCACTAGG - Intergenic
1134516434 16:14891071-14891093 TACGGCCACTTCCCATCCATGGG + Intronic
1134704107 16:16289723-16289745 TACGGCCACTTCCCATCCATGGG + Intronic
1134963436 16:18422391-18422413 TACGGCCACTTCCCATCCATGGG - Intronic
1135341661 16:21653634-21653656 TACTGCCACTGCCAAACACTAGG + Intronic
1136712467 16:32251011-32251033 TACTGCCACTCCATTTCACTGGG - Intergenic
1136755448 16:32678418-32678440 TACTGCCACTCCATTTCACTGGG + Intergenic
1136812665 16:33191952-33191974 TACTGCCACTCCATTTCACTGGG - Intergenic
1136819141 16:33302032-33302054 TACTGCCACTCCATTTCACTGGG - Intronic
1136825704 16:33358567-33358589 TACTGCCACTCCATTTCACTGGG - Intergenic
1136830770 16:33457338-33457360 TACTGCCACTCCATTTCACTGGG - Intergenic
1137701559 16:50501520-50501542 GACAGCAACTCCCCAGCACTGGG - Intergenic
1137701670 16:50502235-50502257 GCCAGCAACTCCCCAGCACTGGG + Intergenic
1137724646 16:50648893-50648915 TTTAGCCACTCCACATCTCTAGG - Intergenic
1138675372 16:58647490-58647512 GCCAGTCACTCCCCATCTCTGGG - Intergenic
1140910704 16:79449200-79449222 TACAGCCACTCCTCGTCACTTGG - Intergenic
1141302200 16:82827440-82827462 CACAGCCTCTCCCCATCATTTGG - Intronic
1202991242 16_KI270728v1_random:14922-14944 TACTGCCACTCCATTTCACTGGG - Intergenic
1203057590 16_KI270728v1_random:938757-938779 TACTGCCACTCCATTTCACTGGG + Intergenic
1142717359 17:1754527-1754549 CACAGCCACGGCCCCTCACTTGG - Exonic
1142718190 17:1759018-1759040 TAAAGCCACTGCCCATTTCTCGG - Intergenic
1143226917 17:5312967-5312989 TACAGGCACACACCATCACCAGG - Intronic
1144936951 17:18907239-18907261 TACAGCCACTCCTGATTCCTGGG - Intronic
1145310382 17:21698023-21698045 CACAGCCACTCACCCTCATTCGG - Intronic
1146496427 17:33326653-33326675 TACAGGCCCTCCCCAGCTCTGGG - Intronic
1148066281 17:44872654-44872676 CACAGCCACTCTCCAGCCCTCGG + Intronic
1148147910 17:45377578-45377600 CCCAGCCACTCCCCCTCACTGGG + Intergenic
1150372280 17:64650310-64650332 TACAGGCACACACCATCACACGG + Intronic
1151715401 17:75828645-75828667 GACAGCCACGGCCCATCTCTCGG - Intronic
1152482046 17:80560748-80560770 CACTGCCACTCCCCAGCACTTGG + Intronic
1155644034 18:28055349-28055371 CACAGCCAATCCATATCACTAGG + Intronic
1155991007 18:32279343-32279365 TACAGCTGCTCTCCATCCCTTGG + Intronic
1160376353 18:78415597-78415619 TAAAGCCTCTCTTCATCACTGGG + Intergenic
1166820015 19:45573226-45573248 CACAGCCACACCGTATCACTTGG - Intronic
1167011516 19:46811686-46811708 TACAGGCACTCACCACCACACGG + Intergenic
1167388293 19:49177660-49177682 TACACCAACTGCCCAGCACTGGG - Intronic
925459035 2:4044053-4044075 CAAAGCTGCTCCCCATCACTGGG - Intergenic
932762051 2:74444450-74444472 TCCAGTCTCTTCCCATCACTTGG + Intergenic
934608058 2:95713108-95713130 GACAGCAACTCCCCTTCAGTTGG - Intergenic
940015509 2:149100247-149100269 AGCAGTCACTCCTCATCACTTGG + Intronic
943791900 2:191942661-191942683 TACAGCACCTCCACATCCCTGGG + Intergenic
947452530 2:230221706-230221728 TGAAGCCCCTCCCCATCACCTGG + Intronic
948900446 2:240954172-240954194 TCCTGCCCCTCCCCTTCACTAGG + Intronic
1168987129 20:2059039-2059061 CATTGCCACTCCCCATCACGAGG - Intergenic
1170172345 20:13429372-13429394 TCTGGCCACTCCACATCACTTGG - Intronic
1176107418 20:63395915-63395937 TGCAGCCCCTCCCCTCCACTGGG - Intergenic
1176449141 21:6848159-6848181 AAGAGACACTCCCCATCATTAGG + Intergenic
1176827309 21:13713183-13713205 AAGAGACACTCCCCATCATTAGG + Intergenic
1177593925 21:23211214-23211236 TACAGACACTGCCCTTCACATGG - Intergenic
1178115692 21:29413884-29413906 TACCTCCACACCCCATCACCTGG + Intronic
1178606891 21:34045411-34045433 TACAGGCACACGCCATCACCCGG + Intergenic
1179506374 21:41844598-41844620 TACAGCCCCTCCCCCTCACAGGG + Intronic
1179506442 21:41844855-41844877 CACAGCCCCTCCCCCTCACAAGG + Intronic
1179506451 21:41844883-41844905 CACAGCCCCTCCCCCTCACAGGG + Intronic
1179506508 21:41845050-41845072 CACAGCCCCTCCCCCTCACAGGG + Intronic
1179506588 21:41845282-41845304 CACAGCCCCTCCCCCTCACAGGG + Intronic
1179506597 21:41845308-41845330 CACAGCCCCTCCCCCTCACAGGG + Intronic
1183654461 22:39176725-39176747 GACAGCCACTTCCCCTCTCTGGG + Intergenic
1184486180 22:44781040-44781062 GACAGCCACTGCCCCTCACTTGG - Intronic
950879963 3:16315590-16315612 TACAGCCACCTCCCATTTCTGGG - Intronic
953930547 3:47003685-47003707 GGCAGCCCCTCCCCATCTCTGGG + Intronic
955463135 3:59207778-59207800 TAGAGCCAAGCTCCATCACTGGG - Intergenic
958897385 3:99844117-99844139 CACTGCCACTACCCAGCACTGGG + Intronic
961007554 3:123415064-123415086 CACAGCCACCCCACATCACCAGG + Intronic
962242820 3:133765589-133765611 CCCAGCCTCTCCCCATCACTTGG + Intronic
965131888 3:164711491-164711513 TACAGCCAAACCATATCACTTGG - Intergenic
965848134 3:172988525-172988547 CTCAGCCTCTCCCCATCTCTTGG - Intronic
966915879 3:184583839-184583861 CACAGCCCCTCCCCCCCACTAGG - Intronic
967091614 3:186139258-186139280 TACAGATACTCCCCTCCACTAGG - Intronic
970893958 4:21079876-21079898 TAGAGGCCATCCCCATCACTTGG - Intronic
971571794 4:28221879-28221901 TACAGACACTCTCCCTCATTTGG - Intergenic
974654957 4:64806657-64806679 TACAGGCACTCACCACCACATGG + Intergenic
975188936 4:71437291-71437313 TACAGCCACTTCCAATAACACGG + Intronic
977175161 4:93810780-93810802 ACCAGCCACTCCCCATAGCTGGG + Intergenic
978256615 4:106699951-106699973 AAAAGTCACTCACCATCACTGGG + Intergenic
981182649 4:141763945-141763967 TACAGCCACTCCCCATCACTCGG - Intergenic
983388854 4:167102885-167102907 TACTGCCCCTCCCCAACACCAGG + Intronic
985189247 4:187353772-187353794 TACAGGCACCCACCATCACCTGG + Intergenic
985394198 4:189524838-189524860 TACAGCAGCACCCCATCACCTGG - Intergenic
985886263 5:2681962-2681984 TCCAGCCACTTCCCACCATTTGG - Intergenic
987335350 5:16893874-16893896 CACAGCCTCTCCCCAGCAGTGGG + Intronic
995841901 5:116450238-116450260 TACACCCCCACCCCATTACTGGG - Intronic
997616889 5:135252661-135252683 TAAAGACACTCCCCAAGACTGGG - Intronic
1002772198 6:299768-299790 TGCAGCAGCTCCCCAGCACTAGG + Intronic
1005278687 6:24247126-24247148 TCCAGCCAGTACCCACCACTTGG + Intronic
1007162531 6:39803506-39803528 TACTCCCACTCCCCATCTCATGG - Intronic
1007696558 6:43737508-43737530 TACAGCCACTGCCCGTACCTGGG - Intergenic
1013617048 6:111853163-111853185 TCCAGCCCCTCCCCACCTCTTGG - Intronic
1013821768 6:114162573-114162595 TACAATGACTCCCTATCACTTGG + Intronic
1014010471 6:116469711-116469733 TACAGCTGCTGCCCATTACTTGG - Intergenic
1014172696 6:118296378-118296400 TACAGCCCCTCCCATTCTCTTGG + Intronic
1021913346 7:25408008-25408030 TGCCCCCACTCCCCATCACTTGG + Intergenic
1022856815 7:34323068-34323090 TTCCCCCACTCCCCATCACCTGG + Intergenic
1026344376 7:69461564-69461586 CACAGCTGCTCCCCATCACTCGG + Intergenic
1027482676 7:78718434-78718456 TATAGCTACTCCCCATTCCTTGG + Intronic
1030304840 7:108006995-108007017 TCCCTCCCCTCCCCATCACTAGG + Intergenic
1031282063 7:119817640-119817662 TACAGCCAAACCATATCACTGGG - Intergenic
1032408627 7:131676167-131676189 TAAAGGCACTTCCCATCATTTGG + Intergenic
1036573500 8:10002671-10002693 CACAGCCAAACCCCATCACATGG - Intergenic
1037096171 8:14990415-14990437 TTCAGCCGCTCCCCATCGCTGGG + Intronic
1037327315 8:17705696-17705718 TGCAACCACTTCCCAGCACTTGG + Intronic
1039604544 8:38869637-38869659 TACAGGCACGCACCACCACTGGG - Intergenic
1042058751 8:64794329-64794351 TTCAGCCACTGCCCACCACTGGG + Intronic
1043097989 8:75999899-75999921 TACAGCTTCTCCCCACCACTCGG - Intergenic
1045974799 8:108120333-108120355 TCCCTCCACTCCCCATCCCTGGG + Intergenic
1046898752 8:119501128-119501150 GACAGCCTCTCCCCGTGACTTGG + Intergenic
1048251723 8:132871577-132871599 TTCAGCCCCTCCCCAGCTCTAGG - Intronic
1048954655 8:139525891-139525913 TTCTCCCACTCCCCAACACTCGG + Intergenic
1050648985 9:7754862-7754884 GACAGCCACGCCCCATCCCCTGG - Intergenic
1051434703 9:17018478-17018500 TAAAGGCACTCCCCATCACAGGG - Intergenic
1051783147 9:20712519-20712541 TACAGGCACCCACCACCACTGGG - Intronic
1055595895 9:77863965-77863987 CACAGCCAAACCACATCACTGGG + Intronic
1056591525 9:87969176-87969198 TACAGCCTCTCCCCCTACCTTGG + Exonic
1060263911 9:122099005-122099027 TACAGGCACTCCCCACCACACGG + Intergenic
1061894710 9:133641237-133641259 TACATCCACTCCCCGTCTCCGGG - Intronic
1062111891 9:134786305-134786327 TTCATCCACTCCCCATCCTTGGG + Intronic
1062299464 9:135856949-135856971 TGCACACACTCCCCAGCACTGGG + Intronic
1203520047 Un_GL000213v1:36357-36379 AAGAGACACTCCCCATCATTAGG - Intergenic
1188770663 X:34149496-34149518 CACAGCCACTCCTTATCACCTGG + Intergenic
1192609715 X:72555080-72555102 TACAGACACTCCCCAGTACCAGG + Intronic
1192980564 X:76335353-76335375 TACATCCACTTCCAATCACATGG + Intergenic
1195698541 X:107684669-107684691 TAAAGTCACTCCCCTTCTCTGGG - Intergenic
1195937361 X:110138480-110138502 TATAGCTACTCCCACTCACTAGG - Intronic
1197985669 X:132264382-132264404 TACTTCCACACACCATCACTTGG + Intergenic
1199566255 X:149218367-149218389 TACACCCACTCCCCATTCTTAGG + Intergenic