ID: 981182651

View in Genome Browser
Species Human (GRCh38)
Location 4:141763963-141763985
Sequence CTGTAAATACACATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981182649_981182651 -5 Left 981182649 4:141763945-141763967 CCGAGTGATGGGGAGTGGCTGTA 0: 2
1: 0
2: 2
3: 22
4: 171
Right 981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981182651 Original CRISPR CTGTAAATACACATGAAGCT GGG Intergenic
No off target data available for this crispr