ID: 981186615

View in Genome Browser
Species Human (GRCh38)
Location 4:141811131-141811153
Sequence AGGTCCCAGACATCTGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981186615_981186618 -8 Left 981186615 4:141811131-141811153 CCATTAGCAGATGTCTGGGACCT No data
Right 981186618 4:141811146-141811168 TGGGACCTCGGATTTGGAGAAGG No data
981186615_981186620 14 Left 981186615 4:141811131-141811153 CCATTAGCAGATGTCTGGGACCT No data
Right 981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981186615 Original CRISPR AGGTCCCAGACATCTGCTAA TGG (reversed) Intergenic
No off target data available for this crispr