ID: 981186618

View in Genome Browser
Species Human (GRCh38)
Location 4:141811146-141811168
Sequence TGGGACCTCGGATTTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981186615_981186618 -8 Left 981186615 4:141811131-141811153 CCATTAGCAGATGTCTGGGACCT No data
Right 981186618 4:141811146-141811168 TGGGACCTCGGATTTGGAGAAGG No data
981186612_981186618 9 Left 981186612 4:141811114-141811136 CCTGTTCGCAAAGCTTGCCATTA No data
Right 981186618 4:141811146-141811168 TGGGACCTCGGATTTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981186618 Original CRISPR TGGGACCTCGGATTTGGAGA AGG Intergenic