ID: 981186619

View in Genome Browser
Species Human (GRCh38)
Location 4:141811151-141811173
Sequence AGGAGCCTTCTCCAAATCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981186619_981186620 -6 Left 981186619 4:141811151-141811173 CCTCGGATTTGGAGAAGGCTCCT No data
Right 981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981186619 Original CRISPR AGGAGCCTTCTCCAAATCCG AGG (reversed) Intergenic