ID: 981186620

View in Genome Browser
Species Human (GRCh38)
Location 4:141811168-141811190
Sequence GCTCCTACCATCCCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981186615_981186620 14 Left 981186615 4:141811131-141811153 CCATTAGCAGATGTCTGGGACCT No data
Right 981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG No data
981186619_981186620 -6 Left 981186619 4:141811151-141811173 CCTCGGATTTGGAGAAGGCTCCT No data
Right 981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981186620 Original CRISPR GCTCCTACCATCCCCAGAAC TGG Intergenic
No off target data available for this crispr