ID: 981201305

View in Genome Browser
Species Human (GRCh38)
Location 4:141982806-141982828
Sequence ATATCCTTTTAGAAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981201305_981201308 18 Left 981201305 4:141982806-141982828 CCTTCAATCTTCTAAAAGGATAT No data
Right 981201308 4:141982847-141982869 TCCATAGTTTAGAGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981201305 Original CRISPR ATATCCTTTTAGAAGATTGA AGG (reversed) Intergenic
No off target data available for this crispr