ID: 981203195

View in Genome Browser
Species Human (GRCh38)
Location 4:142007794-142007816
Sequence AACATGTTTATATGTTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981203194_981203195 20 Left 981203194 4:142007751-142007773 CCTAGATTACTCTGGTTATGACT No data
Right 981203195 4:142007794-142007816 AACATGTTTATATGTTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981203195 Original CRISPR AACATGTTTATATGTTGTAC AGG Intergenic
No off target data available for this crispr