ID: 981203196

View in Genome Browser
Species Human (GRCh38)
Location 4:142007795-142007817
Sequence ACATGTTTATATGTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981203194_981203196 21 Left 981203194 4:142007751-142007773 CCTAGATTACTCTGGTTATGACT No data
Right 981203196 4:142007795-142007817 ACATGTTTATATGTTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981203196 Original CRISPR ACATGTTTATATGTTGTACA GGG Intergenic
No off target data available for this crispr