ID: 981212462

View in Genome Browser
Species Human (GRCh38)
Location 4:142124219-142124241
Sequence CAAGCTAGGACTTGGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981212462 Original CRISPR CAAGCTAGGACTTGGCAAAG GGG (reversed) Intronic
905775201 1:40663819-40663841 CCAGCAAGTACTTGGCACAGGGG + Intronic
907285437 1:53376747-53376769 AAGGCTAGGAGGTGGCAAAGCGG - Intergenic
907761498 1:57366023-57366045 AAAGCTAGGACTATGCAAATTGG + Intronic
909345020 1:74574586-74574608 CAAGATAGGACTTTGCAGACCGG + Intronic
909430478 1:75582385-75582407 CAAGCTTGGAGTGGGCAATGTGG - Intronic
910289733 1:85588522-85588544 CAAGCTAGAACTTGGAATAGGGG - Intergenic
913995566 1:143649776-143649798 CAAGGCAGGAGTTGGCAAAAAGG + Intergenic
915384916 1:155481777-155481799 GAAGTTAGGACTTGGCACTGTGG - Exonic
915553068 1:156646388-156646410 GAAGCTAGGAGGTGGGAAAGGGG + Intronic
915713448 1:157922743-157922765 CAAGCAGGGAGGTGGCAAAGCGG - Intergenic
917439505 1:175054739-175054761 CAAGCTAGGAATGGCCACAGGGG + Intergenic
918243580 1:182640683-182640705 CAACCTAGGACCTGTCCAAGTGG + Intergenic
919608588 1:199717121-199717143 CAAACTAGGAGTTTGCAAACTGG + Intergenic
920836937 1:209519810-209519832 CAAGCAAAGACTTGTCACAGGGG + Intergenic
920850078 1:209622759-209622781 CTAGGTAGGTCTTGGCATAGAGG - Intronic
920964274 1:210689335-210689357 CTAGCTAGGACCAGGCCAAGGGG - Intronic
921111593 1:212043540-212043562 CAAGGTAGGTCTGGGCACAGTGG + Intronic
923174270 1:231448071-231448093 CAGGCTAGGGCTGGGCACAGTGG + Intergenic
1063721510 10:8586651-8586673 CAAACTAAGACTTGACTAAGAGG + Intergenic
1065383013 10:25108920-25108942 AAAGGTAGGACTTCTCAAAGTGG - Intergenic
1070059439 10:72967863-72967885 GAAGCTAGGGCTTGGAACAGGGG + Intergenic
1072986270 10:100143668-100143690 CGGGCTTGGACTCGGCAAAGGGG + Intergenic
1074467834 10:113698967-113698989 CAACATAGGACTTGGAAAAGTGG + Intronic
1076845525 10:133067800-133067822 CAAGCTAGGACGGGGAGAAGCGG - Intergenic
1080174501 11:29345686-29345708 GCAGCTAGGACTAGGAAAAGTGG - Intergenic
1081488869 11:43551816-43551838 GAAACTAGGACTTGGAAAAGGGG - Intergenic
1081571228 11:44292504-44292526 CAAACTAGGACTGGGCATGGTGG - Intronic
1081638302 11:44735453-44735475 GAAGCTAGGAAGAGGCAAAGAGG - Intronic
1083058094 11:59842467-59842489 CCAGCAGGGTCTTGGCAAAGCGG + Exonic
1084539740 11:69778427-69778449 AACCCCAGGACTTGGCAAAGCGG - Intergenic
1087240237 11:95766696-95766718 CTAGCTAGCAAATGGCAAAGTGG + Intergenic
1088140637 11:106611892-106611914 CAAGCTATGACTTGTCCAACTGG + Intergenic
1089657993 11:119965667-119965689 GAAACTAGGAGATGGCAAAGAGG - Intergenic
1091082076 11:132680761-132680783 CAAGCTAGGGCCTGGCTAATAGG - Intronic
1093504107 12:19844702-19844724 CAAGCTAGGACATGGAACATTGG + Intergenic
1093744886 12:22729240-22729262 CAAGCTTGGTCTTGCCATAGTGG + Intergenic
1095573265 12:43706075-43706097 GGAGCTAGGACCTGGAAAAGGGG + Intergenic
1099826713 12:87784717-87784739 CAAACTTGCACTTAGCAAAGGGG - Intergenic
1100367409 12:93934448-93934470 AAAGCCAGGGCTTGGCACAGTGG + Intergenic
1100619876 12:96260756-96260778 AAAGCTAGAATTTGGGAAAGAGG - Intronic
1100805773 12:98282003-98282025 CAGACTAGGACCTGGCACAGAGG - Intergenic
1101143127 12:101816551-101816573 CTAGCAAGGACTTGGCAAAAAGG + Intronic
1103316770 12:120062512-120062534 CAAACTCTGACTTAGCAAAGGGG - Intronic
1103669187 12:122597820-122597842 CAAGCATGGACTCTGCAAAGCGG + Exonic
1104994798 12:132647383-132647405 CAAGGTAGGGCATGGCAAAATGG - Intronic
1107112890 13:36716826-36716848 CAGGCAAGGAGTTGGGAAAGGGG - Intergenic
1112545325 13:100362887-100362909 AAAGCTAGGAATTGGCATAGAGG - Intronic
1114548688 14:23521168-23521190 CAAGGTAGGGATTGGCAGAGGGG + Exonic
1115511098 14:34138721-34138743 CAAGGTAGGGGATGGCAAAGAGG - Intronic
1116077678 14:40132567-40132589 CAAGTTAAGAAGTGGCAAAGAGG + Intergenic
1116922888 14:50599422-50599444 AAAGCTAGGATTTGGGAAAATGG + Intronic
1123983202 15:25622146-25622168 AGAGCCAGGACTTGGAAAAGTGG - Intergenic
1129204721 15:74030122-74030144 CAAGCTGGGGCTGGGCAAGGAGG - Intronic
1136882366 16:33910395-33910417 CAAGCTCTGACTGGGCACAGTGG + Intergenic
1137530576 16:49276427-49276449 CAGGATAGGATTTTGCAAAGCGG + Intergenic
1143423579 17:6815278-6815300 CAAGATTGTACTTGGCAGAGCGG + Exonic
1144842564 17:18197084-18197106 AAAGTTTTGACTTGGCAAAGTGG - Intronic
1146129961 17:30263741-30263763 AAAGCCAGGGCTGGGCAAAGGGG + Intronic
1146532787 17:33624239-33624261 CAAGCTAGGACTTACTTAAGTGG - Intronic
1146602873 17:34233887-34233909 CCTGCTAGGACTTGCCACAGTGG - Intergenic
1147522473 17:41187826-41187848 CAAGCTAGGGCTGGGCGCAGTGG + Intergenic
1147858686 17:43503073-43503095 TAAGCTAGGTCTGGGCAAGGTGG + Intronic
1148899947 17:50867575-50867597 CAAACTCGGACTGGGAAAAGGGG + Intronic
1150133660 17:62682374-62682396 CAAGGTAGGAGGTGGCAATGGGG + Exonic
1152097214 17:78279091-78279113 AAAGCTGGGACATGGCAGAGTGG + Intergenic
1153501202 18:5751806-5751828 TAAGCTAGGAAATGGCCAAGGGG - Intergenic
1158624712 18:59061200-59061222 AAAGGTAGGACCTGGCAGAGGGG - Intergenic
1161063345 19:2226171-2226193 CAAGCCACCACCTGGCAAAGAGG - Exonic
1161435612 19:4261004-4261026 CAAGCGAGTGCTTGGCAAAGGGG + Intronic
1161436441 19:4266433-4266455 CAAGCGAGTGCTTGGCAAAGGGG - Intronic
1163376268 19:16932995-16933017 CAAGAGAGGGCTTGGCACAGTGG + Intronic
1164135105 19:22407342-22407364 CAAAATAGGACTGGGCACAGTGG - Intronic
1165257050 19:34584213-34584235 CATGCAAGGTATTGGCAAAGTGG - Intergenic
1166333165 19:42090369-42090391 AGAGCTAGAACTTGGCAAAATGG + Exonic
1167003372 19:46759056-46759078 TAAGCAAGGACTGGGCACAGTGG + Intronic
1168319617 19:55501082-55501104 CAAGAGAGGACCTGGCCAAGGGG + Exonic
1168604184 19:57745044-57745066 CAAGGTAGCACTTGGAAAAAAGG + Intronic
926578452 2:14608515-14608537 CAAGCTGGGACAAGGCAAGGTGG - Intergenic
929812967 2:45207218-45207240 CAGGCTGCCACTTGGCAAAGTGG - Intergenic
930727306 2:54694739-54694761 GGAGCTAGGGCTTGGGAAAGAGG - Intergenic
932078984 2:68694278-68694300 CAGGCTACGACTTCACAAAGCGG - Intronic
932440570 2:71732040-71732062 CAAAGGAGGACTTGGCAATGAGG - Intergenic
938842415 2:135175714-135175736 CAGGACAGAACTTGGCAAAGTGG + Intronic
940308598 2:152253109-152253131 CCAGCTACGAATTGGCAGAGTGG - Intergenic
944862138 2:203825146-203825168 CAAGTGAGGACATAGCAAAGAGG + Intergenic
946247113 2:218394202-218394224 CAATCCAGCACTTGGGAAAGGGG - Intronic
947893122 2:233643846-233643868 GAAGCTAGGGCCTGGCACAGGGG + Intronic
1172032816 20:31993751-31993773 CTAGCTAGCACTTGTCACAGTGG - Intronic
1175539283 20:59738152-59738174 CCAGCAAGGCCCTGGCAAAGGGG + Intronic
1178216563 21:30605651-30605673 CAAGCTAGGCCCTGGAAAGGGGG - Intergenic
1182975213 22:34617759-34617781 CAAGTTAGGGCTGGGCAAGGTGG + Intergenic
1184572685 22:45336334-45336356 CATGCCAGGACTGTGCAAAGAGG + Exonic
950342938 3:12263696-12263718 CATCCTTGAACTTGGCAAAGTGG + Intergenic
951613568 3:24519311-24519333 CAAGCTGAGACTGGGCACAGCGG + Intergenic
952436067 3:33273803-33273825 CAAGAAAGTACTTGGCACAGTGG + Intergenic
956203132 3:66728269-66728291 CAAGCCAGGATTTGAGAAAGTGG - Intergenic
956766809 3:72491140-72491162 AGAGCTGGGACATGGCAAAGAGG - Intergenic
957784348 3:84862187-84862209 AAAACTGGGACTTGGCAAATGGG + Intergenic
960451789 3:117818767-117818789 CAAACTAGGACTTGCCAACTAGG + Intergenic
961022626 3:123521772-123521794 CCAACTATTACTTGGCAAAGAGG + Intronic
961268526 3:125669601-125669623 CAAGCTAGGGCCTGGCACAGTGG - Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
964486982 3:157196214-157196236 CAAACTAGGACCTGTCAGAGTGG + Intergenic
965191657 3:165538233-165538255 CCAGCCAGAACTGGGCAAAGTGG - Intergenic
969818322 4:9702631-9702653 CATCCTAGCACTTGGCACAGCGG - Intergenic
972714083 4:41628450-41628472 CAAGGAAGGGCATGGCAAAGAGG - Intronic
976216023 4:82716304-82716326 CCAGCTAGGAAATGGCAGAGGGG - Intronic
976398272 4:84581365-84581387 CATGAGAGGACTAGGCAAAGGGG + Intergenic
979623294 4:122819481-122819503 CAAACTAGGGCTGGGCACAGTGG - Intergenic
981212462 4:142124219-142124241 CAAGCTAGGACTTGGCAAAGGGG - Intronic
983423515 4:167551971-167551993 CAAGCTAGGACTGTGCCAAATGG - Intergenic
984919358 4:184750204-184750226 CAAGAGAAGACTTGGCAATGTGG - Intergenic
985482762 5:127387-127409 CAGGCTGGGCCTTGGCACAGAGG - Intergenic
986094768 5:4543749-4543771 CAATCTAGAACATGCCAAAGGGG - Intergenic
986679135 5:10217659-10217681 CAAGGTAGGAACTGGCAAGGTGG - Intergenic
986888530 5:12271060-12271082 TAAGCTAGGGCTTGAGAAAGGGG - Intergenic
989432706 5:41374318-41374340 CAGCCTAGGACTTGGCAAACTGG - Intronic
990579086 5:57150999-57151021 GAAGCTAGGATTTGGAAAGGGGG + Intergenic
992643421 5:78789962-78789984 CAAGCAAGGGCTTGGCAGGGTGG + Intronic
999369134 5:151042551-151042573 CAATCTTGGACTTGGCCAGGAGG + Exonic
1000526650 5:162367518-162367540 TAAGCTAGGAATTTCCAAAGAGG + Intergenic
1001547187 5:172577783-172577805 CAAGAAAGAACTTGGCAAGGGGG + Intergenic
1002158270 5:177299951-177299973 CCTCCTAGGTCTTGGCAAAGAGG + Exonic
1002762887 6:215516-215538 CAAGATTGGTCTTGGCAGAGGGG - Intergenic
1003915496 6:10782863-10782885 CCAGCTAGGGCTGGGCACAGTGG - Intronic
1006334594 6:33413951-33413973 CAAGCAAGGACGGGGCAAACAGG - Intronic
1007963764 6:45985108-45985130 GAAGCTAAGCCCTGGCAAAGGGG + Intronic
1009810742 6:68662041-68662063 CAAGTCAGGAATTTGCAAAGGGG + Intronic
1010454546 6:76039645-76039667 AAAGCTAGGCCTTGGCCAGGTGG - Intronic
1019537151 7:1535197-1535219 CAAGTTGGGACTGGGCACAGTGG - Intronic
1019657808 7:2206394-2206416 GAAGCTAGGGTTTGGCAAAGAGG - Intronic
1020914176 7:14171125-14171147 TAAGCTAAGACTGGGCAAACAGG + Intronic
1023944305 7:44791531-44791553 CAAGCTAGGCCTTGGGCAAGAGG + Intergenic
1027484875 7:78749205-78749227 GAAGCTAAGCCTTGGCAAACAGG + Intronic
1027721276 7:81744586-81744608 ACAGCTAAGACTTGTCAAAGTGG + Intronic
1030646723 7:112069844-112069866 CAAGCTAGAAATTGTCAAACAGG + Intronic
1031572350 7:123374849-123374871 GACACTAGGACTTGGGAAAGTGG - Intergenic
1037765956 8:21772458-21772480 CAAGCTGGGGCTGGGCACAGTGG - Intronic
1038711214 8:29947861-29947883 CCAGCTAGTTTTTGGCAAAGAGG - Intergenic
1038925303 8:32132580-32132602 CAAGACAGGACTTAGCAAATAGG - Intronic
1041158417 8:55011686-55011708 CAATGTATGAATTGGCAAAGGGG - Intergenic
1044846617 8:96388286-96388308 CAACCTAGGACTTTTCAAGGAGG - Intergenic
1045101014 8:98844200-98844222 AAAGGTAGGACTGGGCATAGTGG - Intronic
1046397101 8:113655314-113655336 CAAGCTAGAACTTTGCAAAGTGG + Intergenic
1047466923 8:125125846-125125868 CAATGTAGGACTTGGGACAGAGG - Intronic
1048310546 8:133319255-133319277 CAACCAAGGACTTTGCAATGAGG - Intergenic
1048793285 8:138124240-138124262 CATGCTTAGACTTGGCCAAGGGG - Intergenic
1050457884 9:5850842-5850864 CAAGCTAGGACATGGCCAGAAGG - Intergenic
1051351885 9:16205058-16205080 CAAGCTAGGACTAAGCACACTGG + Intronic
1054982550 9:71223258-71223280 GAAGCTAGGACCTGGAACAGGGG - Intronic
1055686412 9:78779765-78779787 CAAGCTAGGGCTTAGGAAAGAGG - Intergenic
1057206324 9:93175144-93175166 GAACCTAGGACTTGCCACAGAGG + Intergenic
1057329554 9:94100560-94100582 AAAGCTAGAAAATGGCAAAGGGG - Intronic
1057902570 9:98961033-98961055 TAAACAAGGACTTTGCAAAGTGG + Intronic
1062490156 9:136801083-136801105 CACCCTAAGACTGGGCAAAGGGG + Intronic
1186361479 X:8846490-8846512 CAGGCTGGCACTTGGCAAAGAGG - Intergenic
1187452646 X:19412454-19412476 AAAGCTAGGACTTGGATAATCGG + Intronic
1195002417 X:100654873-100654895 CAAGCTAGGAGTTGGGATAAGGG - Intronic
1196711537 X:118768789-118768811 GAAGCTAGGAAGAGGCAAAGAGG + Intronic
1197103306 X:122682231-122682253 AAAGGGAGGACTTGGCGAAGAGG + Intergenic
1197391940 X:125878173-125878195 CAAGCTAGGTCCTGGAATAGGGG + Intergenic
1197821154 X:130542201-130542223 GAAGCTAGGAAGAGGCAAAGAGG - Intergenic
1199039691 X:143097724-143097746 CAAACTAGGACTGGGCACGGTGG - Intergenic
1201963717 Y:19709068-19709090 AAACCTAGGACTTAGAAAAGGGG - Intronic