ID: 981214801

View in Genome Browser
Species Human (GRCh38)
Location 4:142151557-142151579
Sequence GTCTGGGAAAAATCCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981214801_981214806 5 Left 981214801 4:142151557-142151579 CCTGGCTTGGATTTTTCCCAGAC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 981214806 4:142151585-142151607 TTATAGGCTATCACAAAATCAGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981214801 Original CRISPR GTCTGGGAAAAATCCAAGCC AGG (reversed) Intronic
900090630 1:918876-918898 ATCTGGGAGAACTCCAGGCCTGG - Intergenic
900230528 1:1554732-1554754 GCCTGGGAAAAAGCCATGTCAGG + Intronic
902892751 1:19456355-19456377 GTCAGGTGCAAATCCAAGCCAGG + Intronic
903122338 1:21224535-21224557 TGCTGGGAATACTCCAAGCCTGG + Intronic
903275628 1:22219528-22219550 GTCTGGGTACAAACCAAGCCTGG - Intergenic
906058625 1:42934425-42934447 TTCTGGGAAGAAGCCACGCCTGG + Intronic
908796802 1:67838304-67838326 GTCTTGGAGAGATCCAAGCCAGG - Intergenic
911362667 1:96898393-96898415 CTCTGGGAAACATGCAAGGCTGG - Intergenic
912143502 1:106761308-106761330 ATCAGGGAAAAAGCAAAGCCAGG + Intergenic
913035080 1:114956676-114956698 GCCTGGGAAAGATCCAAGGAGGG - Intronic
913272687 1:117109613-117109635 GCCTGGCAAAACTCCAACCCAGG - Intergenic
916434814 1:164768303-164768325 GTGTGGGAAGAATACAAGCTTGG - Intronic
916511465 1:165475433-165475455 GTCTGGGAAATCTCCAAGGATGG + Intergenic
917625689 1:176843708-176843730 GTCAGGGTTAAATCCAGGCCCGG + Exonic
918424244 1:184392242-184392264 TTCTGGGAAAGATCCCAGCATGG - Intronic
920810211 1:209278431-209278453 TTCAGGGAAAAATCCAACCCAGG + Intergenic
922543464 1:226436286-226436308 GTAACGGAAAAGTCCAAGCCTGG + Intergenic
924162833 1:241251803-241251825 TTCTTGAAAAAATCCCAGCCAGG - Intronic
1065294920 10:24265164-24265186 GTCTTTGAAATATCCAAGCTGGG - Intronic
1065352368 10:24806982-24807004 CTCTGCTAAAAATACAAGCCGGG - Intergenic
1066216100 10:33289199-33289221 TTCTGGGAAAACTCAAAGCATGG + Intronic
1067939932 10:50646805-50646827 GTCTTGGAAGAAGCCAAGTCTGG - Intergenic
1069061111 10:63895339-63895361 CTCTGAGTAAATTCCAAGCCGGG + Intergenic
1070519097 10:77236249-77236271 GTCTGGGAAAGATCCAAATATGG - Intronic
1070671934 10:78383852-78383874 TTCTGGCAAATATTCAAGCCTGG - Intergenic
1070689155 10:78511867-78511889 TTCTGGGAAAAAGTCAAGGCCGG + Intergenic
1070799173 10:79235101-79235123 GTCTGGGAGAAATCCAAAGGTGG - Intronic
1073016038 10:100400066-100400088 GTCAGGGGAAAGTGCAAGCCTGG + Intergenic
1074051041 10:109881631-109881653 TCCTGGGAAGAATCCAGGCCTGG - Intronic
1074866361 10:117546410-117546432 CCCTGGGATAAACCCAAGCCAGG - Intronic
1074927546 10:118088630-118088652 GTCTGAGATAAATCCAAGAGGGG + Intergenic
1075087913 10:119425986-119426008 GCCTGTGTAAAATCCATGCCGGG + Intronic
1079327546 11:19507093-19507115 GTCTTGGAAACATCCAAGGAAGG + Intronic
1081630691 11:44687616-44687638 TTCTGGGGAAAACCCAATCCTGG - Intergenic
1084922395 11:72481705-72481727 GTCTGAGGACAATCCTAGCCAGG - Intergenic
1084982573 11:72838731-72838753 GACTGGCCAAACTCCAAGCCTGG + Exonic
1085091522 11:73719393-73719415 GTATGGGAGAAATACAAGCACGG - Intronic
1089244400 11:117108271-117108293 CTGTGGGAAAGATCCAATCCTGG + Intergenic
1089320328 11:117622091-117622113 TTTTGGCAAACATCCAAGCCTGG - Intronic
1092872004 12:12813561-12813583 TTCTGGGGAAAACCCAAGCTAGG - Intronic
1096335835 12:50755210-50755232 GTCTGCGAATTATCCTAGCCTGG + Intergenic
1097543181 12:60965546-60965568 ATCTTGGAAAAATCAAAACCTGG - Intergenic
1097934981 12:65237855-65237877 GTCTGTGAAACATCCAAATCTGG + Intronic
1099818343 12:87676973-87676995 GATTGGGCAAAATTCAAGCCAGG - Intergenic
1099994961 12:89768553-89768575 GTCAGTGAAAAACCCAATCCAGG - Intergenic
1101740545 12:107496548-107496570 GTCTGGGGTTAAGCCAAGCCAGG + Intronic
1104079509 12:125417687-125417709 GTCTGAGAAAAAGCTAAACCAGG - Intronic
1104174187 12:126313536-126313558 GTGTGCGTAAAATCCAGGCCAGG + Intergenic
1106505761 13:30369301-30369323 ATGAGGGAAAAAGCCAAGCCAGG - Intergenic
1106830122 13:33571985-33572007 GTGTGGGAAACAACAAAGCCTGG + Intergenic
1108597387 13:51961157-51961179 GTCTAGGAAAACTCCAAGCAGGG - Intronic
1109802018 13:67392836-67392858 GTCTAGGAAAATTACAAGCTGGG - Intergenic
1111029984 13:82583956-82583978 GGCATGGAAATATCCAAGCCTGG + Intergenic
1112634657 13:101202037-101202059 GTTTGGGAAAAATCGAAACAAGG - Intronic
1116916197 14:50528424-50528446 GGCAGGGAAAAATCCAGGCTTGG + Intronic
1118809979 14:69266129-69266151 TTCTGGTCAAGATCCAAGCCTGG + Intronic
1120403575 14:84065204-84065226 GTATCGTAAAAATCCCAGCCAGG + Intergenic
1121488813 14:94343294-94343316 GTCTGAGAAAACTGGAAGCCAGG + Intergenic
1122542567 14:102506331-102506353 GACAGGGACAAATCCAGGCCTGG + Exonic
1123396632 15:19943959-19943981 GGCGGGGAAAAAGCCAAGGCGGG - Intergenic
1124907419 15:33884050-33884072 GTTTGAGAAAAATCGATGCCAGG - Intronic
1125102490 15:35930616-35930638 GTCTGTGAAGCATCCAAGACCGG - Intergenic
1125699278 15:41667057-41667079 GACTGGCAAAAATCAAAGCCTGG - Intronic
1128532636 15:68465001-68465023 GTCTGGCAGAAACCCCAGCCGGG - Intergenic
1129323227 15:74786367-74786389 CTCTGGGAAAATGCCAAGCTGGG - Intronic
1129861107 15:78862394-78862416 CTCTGGAAAAAATCCGGGCCGGG - Intronic
1130212747 15:81940590-81940612 CTTTGGGGGAAATCCAAGCCTGG + Intergenic
1130433158 15:83869484-83869506 TTCTGGGAAAATTCAAAGGCTGG - Intronic
1133250446 16:4476907-4476929 GCCCGGGAAACAGCCAAGCCGGG - Intronic
1133419835 16:5636807-5636829 GTCTGGGGAAAACCAAAGGCCGG - Intergenic
1134306465 16:13037573-13037595 GATTGGGCAAAATCCTAGCCTGG + Intronic
1135113873 16:19710070-19710092 GACTGGGAAATGTCCAAGCCGGG - Intronic
1137309050 16:47235206-47235228 GCCTGGGAAAATTTCAACCCTGG - Intronic
1137671873 16:50283958-50283980 GTCTGAGACACATCCAATCCAGG - Intronic
1137707090 16:50543168-50543190 GTCTGGGAATAGTCAAAGACTGG + Intergenic
1142560285 17:805408-805430 GCCTGGGGAGAATCCAGGCCTGG + Intronic
1143505733 17:7363981-7364003 GTCTTGGAAAAATAAAAGTCTGG - Intergenic
1143829771 17:9641846-9641868 GGATAGGAAAAAGCCAAGCCTGG + Intronic
1144385589 17:14746455-14746477 GTCGGGGAAAGATGAAAGCCAGG - Intergenic
1144720862 17:17468954-17468976 GTTTTGGAAAAATCCAGGGCTGG - Intergenic
1144749211 17:17636841-17636863 GTCTTGGAAAATTCTCAGCCTGG + Intergenic
1144761299 17:17709081-17709103 ATATGGGAAAAATCCCAGGCCGG - Intronic
1145899501 17:28481009-28481031 ATCTGGGCAAAATCCAAGTTGGG - Intronic
1146045794 17:29505220-29505242 GTATGAAAAAAATCCAAGGCAGG - Intronic
1148091191 17:45023312-45023334 GTGTGGGAAGAAGCCAAGTCTGG + Intergenic
1149045808 17:52244095-52244117 GCCTGGGAAAATTCCAAACCCGG + Intergenic
1149716580 17:58796338-58796360 CCATGGGAAAAAACCAAGCCGGG - Intronic
1154324552 18:13380427-13380449 GTGTGGGAGGAATGCAAGCCAGG - Intronic
1155168207 18:23247962-23247984 GGCGGGGAAAAATCCAAGCTAGG - Intronic
1157381275 18:47220452-47220474 GTCTGTGAAAAATGCCTGCCTGG + Intronic
1157876550 18:51279233-51279255 GTCCAGGAAAATTCCAAGCATGG + Intergenic
1159249715 18:65859020-65859042 GTCTGTGAAAATGCCCAGCCGGG + Exonic
1161286342 19:3470275-3470297 GCCTTGGAGGAATCCAAGCCTGG + Intergenic
1163642359 19:18468979-18469001 GTGTGGAAAAGATCCAAGCAGGG - Intronic
1163658956 19:18565154-18565176 GTCTGGGACAATTCCAACCCTGG + Intronic
1163768674 19:19177829-19177851 GGCTGGGACCAAACCAAGCCGGG + Intronic
1164513674 19:28916780-28916802 GTCTTGGAAAATTCCAATCAGGG + Intergenic
1164713027 19:30372479-30372501 ATCAGGTAAAAATCCAAGCAAGG - Exonic
1164754552 19:30679990-30680012 CCCTGGGAAAAACCCAGGCCAGG + Intronic
1165095618 19:33408220-33408242 GTCTGAGAATAAACCAGGCCTGG + Intronic
1167268006 19:48493083-48493105 GCCTGGAGAAAATCCAAGGCTGG - Intronic
925676641 2:6368855-6368877 GTCAGGGAAAACTCCAAGAATGG + Intergenic
925843029 2:8009987-8010009 GCCTGGGAAAAGCCCCAGCCTGG - Intergenic
925908394 2:8554062-8554084 GTCTGCCAAATATCCAAGTCTGG + Intergenic
928120180 2:28578241-28578263 GTCTGCTAGAAACCCAAGCCGGG - Intronic
932068921 2:68596289-68596311 GACTGGAGAAAATCCAAGCTAGG - Intronic
932210571 2:69925707-69925729 TTCTGGGAAGAATCTAAACCAGG - Intronic
932967089 2:76489073-76489095 TTCTGTTAAAAATCGAAGCCGGG - Intergenic
937069642 2:119053492-119053514 CTCTAGGAAAACTCCAGGCCAGG - Intergenic
937968477 2:127532594-127532616 GGCTGGGAGACAGCCAAGCCTGG + Intergenic
938717202 2:134031619-134031641 GTCTTTAAAAAATGCAAGCCTGG - Intergenic
939996897 2:148928260-148928282 GTCATGTAAAAAACCAAGCCAGG - Intronic
940877483 2:158912533-158912555 TTCTGAGAAAAAGCCAGGCCCGG - Intergenic
941266363 2:163367626-163367648 GCCTGGCAAGAATCCAAGACAGG + Intergenic
943356992 2:186868516-186868538 TCCTGGATAAAATCCAAGCCAGG - Intergenic
945220703 2:207480917-207480939 GTTTGGGAGAAAAACAAGCCTGG + Intergenic
945436043 2:209818408-209818430 CTCTGGGTATAATCCAAGACAGG + Intronic
947567461 2:231203661-231203683 GTCTCTGAAAAAACCAAGGCTGG + Intronic
1169778425 20:9282091-9282113 GTTTGGGAGAAAGCAAAGCCCGG + Intronic
1170615885 20:17950568-17950590 GGCTGGGAAAAATCAAGGGCTGG + Intronic
1172288329 20:33757109-33757131 GTCAGGGAAAAAGCCCTGCCAGG - Intronic
1173042969 20:39482127-39482149 GCCTGGTAAAACTCCAACCCTGG + Intergenic
1173876349 20:46374606-46374628 GTCTGGGTAAAGTCCATGGCTGG + Exonic
1174475168 20:50791096-50791118 GTCTGGGAATAACCCTATCCAGG - Intergenic
1175705622 20:61174503-61174525 GTCTGGATTAAATCCAAGCATGG - Intergenic
1178739843 21:35188353-35188375 CTCAGGGAAAACTCTAAGCCCGG + Intronic
1181741639 22:24925827-24925849 GTCTGGGAACAATCCTCTCCAGG + Intronic
949236447 3:1814851-1814873 GTTTTGGCAAACTCCAAGCCAGG - Intergenic
949379676 3:3430872-3430894 TTCTGGGAAAAAGCCAAGTGTGG - Intergenic
949624177 3:5849089-5849111 GTATGGAAAAAAACTAAGCCTGG - Intergenic
950200139 3:11036808-11036830 CTCTGGGGAAAATCCCAGCCTGG - Intronic
950306594 3:11919592-11919614 GTCTGGGAAAGCTCCCAGCAGGG + Intergenic
951280531 3:20743636-20743658 GTCTTGGAAGAAGCAAAGCCAGG + Intergenic
953820479 3:46203793-46203815 GTCTTGGAAAAGTATAAGCCTGG + Exonic
955894188 3:63681763-63681785 GTCTGGGCTAAATCTAACCCAGG + Intergenic
956236862 3:67082308-67082330 CTCTAGGAGAAATCCAAACCAGG - Intergenic
956677296 3:71748090-71748112 GTTTGGAAAAAATAAAAGCCGGG - Intronic
956689465 3:71862377-71862399 TTCTGGGAAAAATTCAAACTAGG + Intergenic
957779661 3:84802308-84802330 GAGTAGGAGAAATCCAAGCCTGG + Intergenic
961464068 3:127070915-127070937 GGCTGGGAAGACTCCAAGGCTGG + Intergenic
964439240 3:156688736-156688758 GTCCTGGAAATATCAAAGCCAGG + Intronic
964714060 3:159703417-159703439 TCCTGGGAAAAATCCATACCAGG - Intronic
966804266 3:183794281-183794303 TTCTGGGAAAAATCCTTGTCTGG - Intronic
968948418 4:3677613-3677635 GTCTGGGGAAAGTTCCAGCCAGG - Intergenic
969254024 4:5990496-5990518 GTCTGGTGACAATCCCAGCCTGG + Intergenic
975655752 4:76639586-76639608 GTCTGGGAAGCATCAGAGCCAGG - Intronic
976927514 4:90517877-90517899 GTGAGGCAAAAATCAAAGCCAGG - Intronic
977081137 4:92529660-92529682 CTCAGGGTAAAATCCAAGCCAGG - Intronic
981214801 4:142151557-142151579 GTCTGGGAAAAATCCAAGCCAGG - Intronic
983506072 4:168555332-168555354 GCCTGAGAAAAATCCATACCAGG + Intronic
987561067 5:19520661-19520683 GTATGTGAAAATTCTAAGCCTGG - Exonic
987730502 5:21764982-21765004 GTGTGTGAAAATGCCAAGCCAGG - Exonic
989286057 5:39701383-39701405 GACTGGTAAAAACCCAAGCCTGG - Intergenic
995223335 5:109675967-109675989 GTCAAGAGAAAATCCAAGCCCGG - Intergenic
995598994 5:113775897-113775919 GTCTGGGACATTTCCAAGCAGGG + Intergenic
996626632 5:125577866-125577888 GGCTGGGAAAAATGCAAGAGAGG + Intergenic
996850396 5:127944890-127944912 GTCTGAGAAAATTTCATGCCAGG - Intergenic
999004743 5:147963047-147963069 ATCTTGGAAAAGTCCAAGGCTGG - Intergenic
1000379718 5:160617927-160617949 AGCTGAGAAAAATCCGAGCCCGG - Exonic
1003155141 6:3587451-3587473 GTCAGGGAAAAATCAAAGTTTGG - Intergenic
1003388734 6:5693676-5693698 GTCTGGGAAGACTCGAAGACTGG + Intronic
1003701983 6:8476633-8476655 GTCTGGGAGAATTCCAAACATGG + Intergenic
1005339008 6:24825807-24825829 GTCTGGCAAAACCCCAATCCTGG + Intronic
1006438892 6:34041149-34041171 GTCTGGGAAACAGCCAGGACAGG + Intronic
1007983966 6:46188852-46188874 GACAGGGAAGAAGCCAAGCCAGG - Intergenic
1009418815 6:63443106-63443128 GCCTGGTAAGAATTCAAGCCGGG + Intergenic
1010817602 6:80376643-80376665 GTTTGGGAAAAATGCCAGACAGG - Intergenic
1011837920 6:91456913-91456935 GTCTGGGGAAAGTCCATTCCAGG - Intergenic
1014855913 6:126401018-126401040 GTCTGGGTTACATCCAAGTCTGG + Intergenic
1016247063 6:141995106-141995128 GTCTGGGGAACATCCAGTCCAGG + Intergenic
1017599756 6:156067846-156067868 GTGTAGGAAAACTCCTAGCCTGG - Intergenic
1018016271 6:159715098-159715120 GTCTGGGAAATTTCCACTCCTGG - Intronic
1020527852 7:9286523-9286545 GTCTGGGAAAAATATCAGTCTGG + Intergenic
1022518319 7:30989423-30989445 GACTGGGAAAAAACCCAGACAGG - Intronic
1022579157 7:31531026-31531048 GTCTGGGAAAACTCCAGGGCTGG + Intronic
1023640606 7:42253316-42253338 CTCGGGGAGACATCCAAGCCTGG + Intergenic
1026081765 7:67227831-67227853 GTCTAGGAGAATTCCATGCCTGG - Intronic
1026508506 7:71007342-71007364 GTCTGGGAAACAAGGAAGCCTGG + Intergenic
1029606805 7:101603946-101603968 GTCTGGGAAAAGGCCAGGCGCGG - Intergenic
1031799782 7:126227892-126227914 CTATGGGAGAAATCCAAACCAGG - Intergenic
1032942524 7:136811051-136811073 GAAAGGGAAAAATACAAGCCTGG + Intergenic
1033652937 7:143355757-143355779 ATCTGGGAAAAGACCCAGCCAGG - Exonic
1035112867 7:156497844-156497866 GTCTGCGAAAGATGAAAGCCAGG + Intergenic
1037165757 8:15826551-15826573 CTCAGATAAAAATCCAAGCCTGG - Intergenic
1041862875 8:62534168-62534190 GTATGGGAACAAGCCTAGCCGGG - Intronic
1046509213 8:115178450-115178472 ATCTGAAAAAAATCCAAGCCAGG + Intergenic
1047570101 8:126088441-126088463 GACTGTAAAATATCCAAGCCAGG - Intergenic
1047726913 8:127691974-127691996 GTCTGGGTAATATGCCAGCCAGG + Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1050381033 9:5030611-5030633 GTCAGGTTCAAATCCAAGCCTGG + Intronic
1051408081 9:16760530-16760552 ATCCAGGATAAATCCAAGCCTGG + Intronic
1052832677 9:33228841-33228863 GTCTGGGAAGATGCCAAGCTGGG + Intronic
1055178548 9:73352270-73352292 GTGAGGGAACTATCCAAGCCTGG - Intergenic
1056092558 9:83218838-83218860 GTCTGGGAACTATCCCAGCGTGG + Intergenic
1059557665 9:115297631-115297653 TTCTGGGAATATCCCAAGCCAGG - Intronic
1060811421 9:126613235-126613257 GTCTGGGAAAGCTCCGGGCCTGG - Intergenic
1062292475 9:135803048-135803070 GTCCAGGAAAAGTCCAATCCTGG + Intergenic
1062382126 9:136291535-136291557 GTCTGGGAACACACCCAGCCTGG - Exonic
1185499429 X:585501-585523 GCCTGGGAGAACTCAAAGCCGGG - Intergenic
1186229705 X:7439894-7439916 CTCTGGGAAAAATCCATTCCAGG - Intergenic
1187166332 X:16807437-16807459 GGCTGGGAAAATTCAAAACCAGG - Intronic
1191149219 X:57202927-57202949 GTCTGGCAAAATTCCTAGCAGGG - Intergenic
1192138601 X:68629781-68629803 GTCTGGGAAAGAGCCAGGCCTGG - Intergenic
1194857176 X:98946078-98946100 TTCTGGCAAAATTCCAACCCTGG - Intergenic
1196376266 X:115036315-115036337 GTTTTGGAAAAATTAAAGCCAGG - Intergenic
1199853072 X:151739038-151739060 GTCTGGGCAAACCCCAAGGCAGG + Intronic
1200274309 X:154717477-154717499 ATCTTGGAAAGAGCCAAGCCTGG + Intronic
1202150257 Y:21837758-21837780 GTCTGTGACAATTGCAAGCCTGG + Intergenic