ID: 981216624

View in Genome Browser
Species Human (GRCh38)
Location 4:142177084-142177106
Sequence CTGAATTAGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981216624_981216629 6 Left 981216624 4:142177084-142177106 CCTGCCTCTTTCTCCTAATTCAG 0: 1
1: 0
2: 4
3: 33
4: 505
Right 981216629 4:142177113-142177135 TTGGAGCAGAGTTGTGTAGCAGG 0: 1
1: 1
2: 0
3: 20
4: 151
981216624_981216630 12 Left 981216624 4:142177084-142177106 CCTGCCTCTTTCTCCTAATTCAG 0: 1
1: 0
2: 4
3: 33
4: 505
Right 981216630 4:142177119-142177141 CAGAGTTGTGTAGCAGGCATCGG 0: 1
1: 0
2: 3
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981216624 Original CRISPR CTGAATTAGGAGAAAGAGGC AGG (reversed) Intronic
900782609 1:4627864-4627886 CGGATTTAGCAGATAGAGGCAGG + Intergenic
901184970 1:7367109-7367131 CTCCATTATGAGAAAGAGACGGG + Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903685184 1:25126349-25126371 ATGTATTAGGAGAAAGTGACTGG + Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904692580 1:32304858-32304880 CTGAATTAGCCAAGAGAGGCTGG - Intronic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905075895 1:35269630-35269652 CTGATTTAGGAGAAAGATTTTGG + Intronic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907269995 1:53285409-53285431 ATGATGTAGGAGAAAGAGCCTGG + Intronic
908253077 1:62280485-62280507 CTGCATTTGGAAGAAGAGGCAGG + Intronic
908393638 1:63705607-63705629 CTGACTTGGGGCAAAGAGGCTGG - Intergenic
908453630 1:64280789-64280811 ATGAGGTAAGAGAAAGAGGCAGG + Intergenic
908511600 1:64854127-64854149 CTGAACTTGGTGAAAGAGGAGGG - Intronic
909044534 1:70692991-70693013 ATGAAATTGAAGAAAGAGGCAGG + Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
909798104 1:79769579-79769601 CTGGATTATGAGGAAGAGTCTGG + Intergenic
909850585 1:80458120-80458142 CTGAGGTATGAGAAAGAGACTGG - Intergenic
910176310 1:84434551-84434573 CTGAGTTAGAAAAAACAGGCTGG - Intergenic
910354539 1:86340544-86340566 TTGAATGAGGAAAAAGAGGTAGG - Intergenic
910713803 1:90208689-90208711 CTTCAGTAGAAGAAAGAGGCTGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911776165 1:101815480-101815502 CTGATTTAGGTGAAAGATGATGG + Intronic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
913529423 1:119723044-119723066 CTGAAATAGGAGAAAGAAAAGGG + Intronic
913588738 1:120302342-120302364 GTGAAGTAGGAGAAAAAGTCTGG + Intergenic
913619447 1:120596027-120596049 GTGAAGTAGGAGAAAAAGTCTGG - Intergenic
914570761 1:148914213-148914235 GTGAAGTAGGAGAAAAAGTCTGG + Intronic
914602069 1:149216050-149216072 GTGAAGTAGGAGAAAAAGTCTGG - Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
915445406 1:155971750-155971772 TTGAATTAAAAGCAAGAGGCCGG + Intronic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916456273 1:164973922-164973944 TTGCATTAGGAGAAAGAGCATGG + Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917156142 1:172001043-172001065 TTGATTTAGGAGAATGAGGATGG + Intronic
917209584 1:172617821-172617843 CTAAATTAGGATAAAGCTGCGGG + Intergenic
917498117 1:175561039-175561061 CTGAATTAGAAGAACAAGGAAGG - Intronic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918303327 1:183223812-183223834 GTGAGGTAGGAGAAAGAGGTGGG + Intronic
918563866 1:185902626-185902648 ATGAATGAGGAGAAAGAGTCAGG + Intronic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
921841850 1:219836630-219836652 CTGAGATTGAAGAAAGAGGCTGG - Intronic
922565559 1:226599282-226599304 CTGAGTTGGGTGAAAGAGTCTGG - Intronic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
924772271 1:247088460-247088482 CTGAGTTGGGAGAATCAGGCAGG + Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064891795 10:20183558-20183580 CTGAATTGGGAGACAGAAGGAGG + Intronic
1065780177 10:29160036-29160058 CTGAAATAGGAGCAAGAGCTTGG + Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070354249 10:75624217-75624239 CAGAATTAGGAGAAAGACTAAGG + Intronic
1070523151 10:77271950-77271972 CTGAATAAGGAGAAATAACCTGG - Intronic
1071335433 10:84596593-84596615 CTGAATTTCTAGAAAGGGGCTGG - Intergenic
1071741959 10:88369403-88369425 CTCAGGTAGGAGACAGAGGCTGG + Intronic
1073015616 10:100396799-100396821 CTGAATCAGGAGTAATGGGCAGG + Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074753000 10:116604987-116605009 ATCTATTAAGAGAAAGAGGCCGG - Intronic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1076311875 10:129514014-129514036 CTGAATTAGAGGAAAAATGCTGG - Intronic
1076751381 10:132545191-132545213 CTGATTTTGGGGGAAGAGGCTGG + Intronic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1078593199 11:12663732-12663754 CTGATTTAGGAGGAAGAGAAGGG - Intergenic
1078898315 11:15617854-15617876 AGGGAATAGGAGAAAGAGGCTGG - Intergenic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1081263940 11:40995835-40995857 ATGAATTTGGAGATATAGGCTGG - Intronic
1081312437 11:41590363-41590385 CTGAATTCTGAGACAAAGGCGGG + Intergenic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082272416 11:50185854-50185876 CTGAATAATGAGAAAAAGCCAGG - Intergenic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1087533509 11:99414105-99414127 GTGGTTTAGGAGGAAGAGGCAGG - Intronic
1088461325 11:110086516-110086538 CTGAACTAGCAGAAGAAGGCAGG - Intergenic
1088560797 11:111114091-111114113 ATGAAATTGGAGAAAGAGACAGG - Intergenic
1089427752 11:118393890-118393912 CTGAATTAGAAAAAGCAGGCTGG - Intronic
1090082055 11:123620175-123620197 CTAAGTAAGGAAAAAGAGGCCGG + Intronic
1090669784 11:128938092-128938114 CTGAATTTGGGGAAAGGGGGTGG + Intronic
1090889740 11:130913256-130913278 CAGAATTAGAACAAAAAGGCAGG + Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1095191099 12:39258926-39258948 CTGAATTAGAACAAGGAGTCTGG + Intergenic
1095643279 12:44509992-44510014 ATGAAATAGGATAAATAGGCAGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097362205 12:58670566-58670588 CTGGATGAGGAGGCAGAGGCAGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097707909 12:62887098-62887120 CTGGATGTGGAGAAAGAGGGAGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098222600 12:68285836-68285858 CAGATTTGGGAGAAAGAGGTGGG + Intronic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1099288847 12:80749822-80749844 CTGTCTTAGGAGAAAGAAACAGG - Intergenic
1099585765 12:84510363-84510385 TTGAAATAGGAGAAAGAAGAGGG - Intergenic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100160552 12:91855432-91855454 CTGAAATAGAAAAAAGTGGCAGG - Intergenic
1100183617 12:92112645-92112667 ATGAAATATGAGAAAGTGGCTGG - Intronic
1102590008 12:113949861-113949883 CTGACTTAGGAGGGAGAGACAGG - Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1108882434 13:55137105-55137127 CAGGAGTAGGAGAAAGAGACCGG - Intergenic
1109285000 13:60398269-60398291 CTGCTTTAGGAGAAAGAGTGAGG + Intronic
1110045170 13:70819079-70819101 CTGAATTGGGAGGCCGAGGCAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1114553471 14:23547765-23547787 TTGAATTAGTAGGGAGAGGCTGG - Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115703899 14:35978532-35978554 CTGAGGCAGGAGAAACAGGCAGG + Intergenic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1115994779 14:39184990-39185012 CTGTATTAGGAAAGACAGGCTGG + Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1117730591 14:58718321-58718343 CTGAACTGGGGGAGAGAGGCAGG - Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1118990271 14:70791416-70791438 ATGAAATAGGAAGAAGAGGCAGG + Intronic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1120464301 14:84836811-84836833 GTGAATTATGTGAAAGAGTCAGG + Intergenic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120892724 14:89505371-89505393 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122090401 14:99334667-99334689 GTGATTTAGGGGAAAGCGGCAGG + Intergenic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124607742 15:31184064-31184086 CTGAGGTAGGAGAATCAGGCAGG - Intergenic
1124939018 15:34200559-34200581 CTGAATTAAGAGAAAGTGGTGGG - Intronic
1125311483 15:38383532-38383554 CTGAATTAGAAGAAAGAAGTTGG + Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1126795036 15:52253784-52253806 CTGCATTAGGCCAAAGAGGCTGG - Intronic
1127612939 15:60654784-60654806 CTGACTTTGGAGACAGAGGAAGG + Intronic
1128129186 15:65214489-65214511 CTGAATGAGGAGACCCAGGCAGG - Intergenic
1129274883 15:74438468-74438490 CTGGTCTAGGAGGAAGAGGCAGG - Intergenic
1129552664 15:76470354-76470376 CTGAATCTGGGGAAAGAGTCAGG + Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130669110 15:85894649-85894671 CTTAACTAGGAGAAAGAGTCAGG + Intergenic
1130716282 15:86338139-86338161 CTGAATTATGAGAAAAGGTCAGG + Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132374724 15:101321384-101321406 CTGATCTGGAAGAAAGAGGCAGG + Intronic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133605190 16:7379966-7379988 CTAACTTTGGAGAAGGAGGCAGG - Intronic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134327971 16:13224470-13224492 CTGAAATATGAGAAATGGGCAGG - Intronic
1135464886 16:22676702-22676724 CTGAATTAGAAAAATCAGGCAGG + Intergenic
1135775755 16:25256745-25256767 GTGCATTTGGAGAAAGAGACTGG - Exonic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1137830311 16:51537921-51537943 CTGAATTAGAAGGAGGAGTCTGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1139004180 16:62551195-62551217 CGGAAGTAAGAGAAAGAAGCTGG - Intergenic
1139457614 16:67094918-67094940 CAGAATTTTAAGAAAGAGGCCGG + Intronic
1140468260 16:75199358-75199380 CTGAAAAAGTAAAAAGAGGCCGG - Intergenic
1140792067 16:78401537-78401559 ATGATTTAGGGGAAAGAGTCTGG + Intronic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1142952275 17:3493264-3493286 CTTAGTTAAGAAAAAGAGGCTGG + Intronic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143506639 17:7369598-7369620 CTGGATTAGGAGAGTGAGACTGG - Intergenic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143742417 17:8964450-8964472 ATGAATCAGGAGACTGAGGCTGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144087000 17:11818985-11819007 CTGAATTAGGAAGTAGGGGCGGG - Intronic
1144559939 17:16312820-16312842 CTGAGGTAGGAGAATCAGGCAGG + Intronic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1146435990 17:32848323-32848345 AAGAATTAGGGGAAAGGGGCAGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1147548397 17:41420845-41420867 CCGAGTTAGGAGATTGAGGCTGG - Exonic
1147695427 17:42348820-42348842 CTAAACTGGGAGAAACAGGCTGG - Intronic
1147801154 17:43089329-43089351 AAAAATTAGGAGAAAGAGCCTGG + Intronic
1148022867 17:44565200-44565222 CTGAATCAGGAGATAGAGAGAGG + Intergenic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148403964 17:47395031-47395053 ATGGATTAGGAGAAAGCGGAGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148726737 17:49797445-49797467 CTGTAATAGGAAAAAGAGACTGG + Intronic
1149307978 17:55367707-55367729 CTGATTTAGGAGAAATCGGGTGG - Intergenic
1149311003 17:55393636-55393658 CTGAATTCAGAGTAAGAGGTTGG + Exonic
1151813651 17:76460104-76460126 CTGAAGTAGGTGACTGAGGCTGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152688176 17:81704936-81704958 CTGAGAGAGGAAAAAGAGGCTGG + Intronic
1153035841 18:761641-761663 CTGGATTAAGAAAATGAGGCTGG - Intronic
1153419101 18:4884464-4884486 CTCAATTAAAAGACAGAGGCTGG - Intergenic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1153990738 18:10397210-10397232 CTGGATGAGGAAAGAGAGGCGGG + Intergenic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154133769 18:11758874-11758896 ATGAAATAGGAAAAATAGGCCGG + Intronic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1155963768 18:32017672-32017694 TTTAATTAGGAGATATAGGCCGG - Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156951209 18:42900600-42900622 CTGTATTAGAAGACAGAGTCAGG - Intronic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1158344883 18:56506281-56506303 CTGAAGTGAGAGAGAGAGGCTGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159257796 18:65970864-65970886 CTGAATTAAGGGAAAGGGGTGGG + Intergenic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160130821 18:76223516-76223538 CTGTACTTGGAGAAAGAAGCAGG - Intergenic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162318774 19:9958428-9958450 TTGAATTAGGAGTAAGATGTTGG - Intergenic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164812191 19:31166071-31166093 CTGAATTAGAAAAAAGCTGCTGG - Intergenic
1165762237 19:38328182-38328204 CTGAACTATGAGAAATAGGCAGG + Exonic
1165924233 19:39317285-39317307 CTGAAGGCGGAAAAAGAGGCCGG + Intergenic
1166017306 19:39992174-39992196 CAGAATTATGACAAAGAGACAGG - Intronic
1166691658 19:44825183-44825205 ATGAAATATCAGAAAGAGGCAGG + Intergenic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1167767015 19:51490336-51490358 CTGTGTGGGGAGAAAGAGGCCGG - Intronic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167910878 19:52700778-52700800 CTGAAGGAGGAGAAAGTGACAGG + Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
925600000 2:5598555-5598577 CTAAATAAGGAGAGAGAGGTGGG + Intergenic
925819267 2:7783550-7783572 CTGGATGAGGGGAAAGAGACAGG + Intergenic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
927329371 2:21843851-21843873 AGGAATTAAGAGAAAGAGGGTGG - Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927781568 2:25943422-25943444 CTGACTTAGCAGAGAGAGTCTGG - Intronic
927918431 2:26951690-26951712 CTGAGTTAGAAAATAGAGGCTGG - Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929110514 2:38402792-38402814 CTGAGTTAGGAGAATCAGGCAGG - Intergenic
931215774 2:60242882-60242904 CTTAAAGAGGAGAGAGAGGCAGG - Intergenic
931240395 2:60447174-60447196 CTGAAATAGGAGAAAGACAGCGG - Intergenic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
931680304 2:64741340-64741362 TTAAATTAGGGGAAAAAGGCTGG - Intronic
932215441 2:69963146-69963168 CTGAATCAGGTGGAAGGGGCTGG - Intergenic
932252121 2:70253531-70253553 TTAAACTTGGAGAAAGAGGCTGG - Intergenic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
935381420 2:102454689-102454711 CTGCACTAGGAGGAAGAGACAGG - Intergenic
936854460 2:116939744-116939766 ATGAATTAGAAGAAAAATGCTGG - Intergenic
936960096 2:118063998-118064020 CTCAAGTAGGAGAAAGAGGCAGG + Intergenic
938639178 2:133262588-133262610 GTTTATTAGGAGAAAGAGGATGG + Intronic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
939495259 2:142920859-142920881 GTGAGGTAGGAAAAAGAGGCAGG - Intronic
939496946 2:142936085-142936107 TTGAATGAGGAAAAAGAGGTAGG + Intronic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
940924599 2:159350162-159350184 CTTAATTTGGAAAAAGAGCCAGG + Exonic
940961400 2:159790463-159790485 GTGAACTAGGATAAAAAGGCAGG + Intronic
942143250 2:172999294-172999316 CTGATTTATGAGAAAGATACTGG - Intronic
942714905 2:178881133-178881155 GTGAATTAGGAGAAAGGAGAAGG + Intronic
944417449 2:199493008-199493030 ATGAAGTAGGAGAGAGGGGCAGG + Intergenic
945002765 2:205369299-205369321 CTGAATTAGGAGAATAAGGGTGG - Intronic
945779152 2:214146335-214146357 CTGAAATGGGAGAAAGAAGAAGG + Intronic
946469203 2:219940662-219940684 CTCACCTAGGAGAAAGAGGAAGG - Intergenic
946770591 2:223084875-223084897 CTGAATAATGAGAGAGAGCCAGG - Intronic
947021822 2:225686421-225686443 TTGCATTAGGAGAAAAAGCCAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948078375 2:235184984-235185006 CTGAATTAGGCCACAGATGCTGG - Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948903648 2:240967929-240967951 CTCAATTAAAGGAAAGAGGCAGG + Intronic
948924818 2:241088706-241088728 CTGCAGTGGGAGGAAGAGGCAGG + Exonic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1172494562 20:35370341-35370363 TTGAAATAAGAGAAAGGGGCTGG - Intronic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1172732083 20:37096451-37096473 TTGAGTTAGGAGATGGAGGCTGG + Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1173745846 20:45436557-45436579 CTCTATTTGGAGAAAGAGGTAGG - Intergenic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1175270540 20:57730855-57730877 CTGAAGGGTGAGAAAGAGGCAGG - Intergenic
1175294484 20:57899014-57899036 CTGGATTTGGAGATAGAGGAGGG - Intergenic
1176344229 21:5727018-5727040 CTCAATTAAGAGACAGAGCCTGG - Intergenic
1176351043 21:5847602-5847624 CTCAATTAAGAGACAGAGCCTGG - Intergenic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176500598 21:7597438-7597460 CTCAATTAAGAGACAGAGCCTGG + Intergenic
1176538550 21:8125087-8125109 CTCAATTAAGAGACAGAGCCTGG - Intergenic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1177240034 21:18444124-18444146 CTGAAGTAGGACTACGAGGCTGG - Intronic
1180797241 22:18611817-18611839 CTGTACTTGGAGAAAGGGGCAGG + Exonic
1181224482 22:21383454-21383476 CTGTACTTGGAGAAAGGGGCAGG - Exonic
1181254150 22:21551359-21551381 CTGTACTTGGAGAAAGGGGCAGG + Exonic
1181296830 22:21847096-21847118 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1181525775 22:23485279-23485301 CTGAATTATGATAAAGTGGTTGG - Intergenic
1181784188 22:25214473-25214495 ATGAATTAGTAGAAAGAAACAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183309395 22:37101282-37101304 CTGAAGCAGGAGACAGGGGCAGG + Intronic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1203243496 22_KI270733v1_random:41442-41464 CTCAATTAAGAGACAGAGCCTGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
952959056 3:38578406-38578428 CTATATAAGGAGAAACAGGCTGG - Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953272765 3:41461418-41461440 CTGAATTAGGTGGAAGAGTTGGG - Intronic
953589379 3:44236865-44236887 CTGAATAAGGAGAAAGGAGGGGG - Intergenic
953875157 3:46662453-46662475 GTGAGTCAAGAGAAAGAGGCTGG + Intergenic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955407428 3:58634210-58634232 CTGACTTAGGAGTCAGAGCCCGG - Exonic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
956258835 3:67314513-67314535 CTGAGATATGAGGAAGAGGCAGG - Intergenic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959820486 3:110729653-110729675 TTGAAGTAGGAGAGAGAGGTAGG + Intergenic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
961702541 3:128757631-128757653 CCCAGTTAGGAGAATGAGGCAGG - Intronic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962230735 3:133663247-133663269 CTGAATTAGGAGAGAGAGAGTGG - Intergenic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963544182 3:146633872-146633894 CTGAAGGAGGAGAAAAAAGCTGG - Intergenic
965019086 3:163203095-163203117 CTGAATAAAGTGAAAGAGACTGG + Intergenic
966118620 3:176496361-176496383 CCGAACTAGGAGGAAGAGGTAGG - Intergenic
967149736 3:186637584-186637606 CTGAGTGAGGAGGGAGAGGCAGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
969969803 4:11033911-11033933 GTCAATTAGAAGAAAGAGCCAGG - Intergenic
970306687 4:14739902-14739924 CTGAGATAGGAGGGAGAGGCAGG - Intergenic
970453072 4:16191174-16191196 CTGATTTAGGAGATCTAGGCTGG - Intronic
970928748 4:21484128-21484150 ATGATTTATGAGAAAGGGGCTGG + Intronic
971304523 4:25467983-25468005 TTGAAATAGGAGAAATAGGCCGG + Intergenic
971607119 4:28671919-28671941 CTCACTGAGGAGAAAGGGGCAGG - Intergenic
973936787 4:55854141-55854163 GTGAATTTGGACAAAGAGGAAGG - Intronic
974440832 4:61914807-61914829 TTGCATCAGGAGAAAAAGGCAGG + Intronic
974467418 4:62274695-62274717 CTAAATTTGGGGGAAGAGGCTGG - Intergenic
974849930 4:67392024-67392046 ATCAATCAAGAGAAAGAGGCAGG + Intergenic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976886118 4:89986598-89986620 ATGAGTTTGGAGAAAGAGGAAGG - Intergenic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
978606545 4:110486533-110486555 CTGAATAATGAGAAAAAGCCAGG - Intronic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979494306 4:121367175-121367197 TTAAATTACGAGACAGAGGCAGG + Intronic
980908382 4:138971559-138971581 CTGGAAGAGGTGAAAGAGGCAGG + Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
981341862 4:143630764-143630786 GTATGTTAGGAGAAAGAGGCTGG + Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985222980 4:187727744-187727766 CTGGATGATGGGAAAGAGGCAGG + Intergenic
985606552 5:861212-861234 CTGAATTGGGAGGCAGAGGAGGG - Intronic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986818215 5:11436006-11436028 CTGGAATAGGAGAAAGACGACGG + Intronic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
990335341 5:54767090-54767112 CTGAATTGAGGGAAAGGGGCTGG - Intergenic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
991529012 5:67594988-67595010 AGGAATTAGGAGGAAGAGGCAGG + Intergenic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
993089305 5:83404445-83404467 CTTAATTTGGAAAAAGAGACAGG - Intergenic
993701367 5:91122941-91122963 CAGGAGTAGGAGAAACAGGCAGG - Intronic
995104647 5:108361621-108361643 TTGACCTAGGAGAAAGAGCCTGG - Intronic
995759310 5:115546491-115546513 TTGAATTAGGTGAGAGAGACAGG - Intergenic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998056542 5:139083060-139083082 CTGATTTAGGAGCAAGAAGCAGG + Intronic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
1000496610 5:161991953-161991975 CTGAATAGGGAGAAATAGTCAGG - Intergenic
1001499106 5:172214980-172215002 CCGAAATAGGAGAGACAGGCAGG + Intronic
1001630963 5:173175197-173175219 CTGCATTAAGAGAAGCAGGCTGG - Intergenic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1004135605 6:12963105-12963127 CAGAATTCAGAGAAAGAGACAGG + Intronic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004891552 6:20105694-20105716 CTGAACCAGGAGGCAGAGGCTGG + Intronic
1005423881 6:25680876-25680898 CTGGATTTGGAGACAGAGGAAGG + Intronic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1007453392 6:41957429-41957451 CTGGATTTGGAGAAAGAAGCAGG - Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008480950 6:51984068-51984090 CTGAGTTATGACAAAGGGGCAGG + Intronic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1008928471 6:56912076-56912098 CTGTCTTGGGAGAAAGAGCCTGG - Intronic
1009734852 6:67663188-67663210 CTGCAGTGGGAGAAAGATGCTGG + Intergenic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1011204131 6:84873366-84873388 CTGAATTTGGAGAAAAAAGTAGG - Intergenic
1011529320 6:88302763-88302785 TGGAATTTGGAGACAGAGGCAGG + Intergenic
1011822915 6:91273805-91273827 ATGAATTAGGCGAAGGAGCCAGG + Intergenic
1011957648 6:93043088-93043110 CTGAATTAGGAGAACCAGTGGGG - Intergenic
1011987447 6:93466551-93466573 CTGAATTATTACAAAGAGCCAGG + Intergenic
1012393424 6:98769215-98769237 CCAACTTAGGAGAAAGATGCAGG + Intergenic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1014383335 6:120771632-120771654 TTTAAATAGGAGAAAGAGGGAGG - Intergenic
1014699508 6:124666293-124666315 CTGAAATAGGAGAATGAAGGTGG + Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014780930 6:125563823-125563845 CTGAATTCTGAGAATGAGGTGGG - Intergenic
1014919645 6:127198621-127198643 CTGAATTCGGAGAACAGGGCAGG - Intergenic
1015053137 6:128865959-128865981 CTGCAATAGGAGAAAGAGATTGG - Intergenic
1016858216 6:148693523-148693545 CTGAGTCAGGAGACTGAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016924478 6:149329226-149329248 CAGACTTGGGAGGAAGAGGCAGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018089452 6:160333142-160333164 GTGAGGTAGGAGAAAGAGGGAGG + Intergenic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018688864 6:166327263-166327285 GTGAGTTAGGAGGCAGAGGCAGG + Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020893255 7:13906114-13906136 CTGAATTAGAGAAAAGAGGCAGG - Intronic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022873898 7:34507966-34507988 CTGAACTTAGAGAAAGAGGTTGG - Intergenic
1024094132 7:45970998-45971020 CAGAAATAGGAGAAACAGACTGG - Intergenic
1024364876 7:48509287-48509309 CTGGACCAGGAGACAGAGGCTGG - Intronic
1024478348 7:49838172-49838194 GTGAATTAGGAGGCAGAGGCAGG + Intronic
1024482129 7:49874829-49874851 CTGAATTAGGGAAGAGGGGCAGG - Intronic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025624385 7:63206922-63206944 CTGAATAATGAGAAAAAGCCAGG - Intergenic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1030067779 7:105673647-105673669 CTGGAGTTGGAGAGAGAGGCAGG + Intronic
1030230866 7:107207211-107207233 CTGAAATAGGACGAAGAGGGAGG - Intronic
1032345968 7:131117133-131117155 ATAAATTATGTGAAAGAGGCTGG + Intronic
1032360245 7:131248737-131248759 CTGATTTAGGAAAAAGTGGATGG + Intronic
1032414624 7:131726513-131726535 TTAAATTAGGAGAAAGAGAGAGG - Intergenic
1032613927 7:133445486-133445508 CTGAAGTAGTGGAAAGACGCTGG - Intronic
1032957605 7:136989611-136989633 TTGAATTTGGAGAATGAGGGAGG - Intronic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035820190 8:2583229-2583251 CTGATTTAGGATAAAGAGTTTGG + Intergenic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1037138455 8:15491663-15491685 CTGATTTACAAGGAAGAGGCTGG + Intronic
1037915370 8:22769653-22769675 GTGATAAAGGAGAAAGAGGCTGG - Intronic
1038428909 8:27484241-27484263 CTCATTTAGGAAAAAGAGACTGG + Intergenic
1038964083 8:32551843-32551865 CTGAATCAGTATGAAGAGGCTGG - Intronic
1039205495 8:35148752-35148774 TCGAATTAAGAGAAAAAGGCCGG + Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1039743588 8:40404095-40404117 TTTAATGAGGAGAAAGTGGCTGG + Intergenic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1042305406 8:67325884-67325906 ATGAAATATGAGAAAAAGGCTGG + Intronic
1043484580 8:80686637-80686659 CTGCTTTGGGAGACAGAGGCAGG - Intronic
1043620287 8:82182405-82182427 CTGATTTAGGAAACAGAAGCAGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1046034030 8:108820157-108820179 CTTCATTGGGAGAAAGAGGAAGG + Intergenic
1047725263 8:127678949-127678971 CTCAATTTGGAGAAAGTGGTGGG - Intergenic
1048313355 8:133343400-133343422 CTGATTGAGTAGATAGAGGCTGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049024265 8:139977975-139977997 TTAAATTAGGAGTAGGAGGCTGG - Intronic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1052249462 9:26380358-26380380 CTTATTTAGGAGCTAGAGGCTGG + Intergenic
1052549645 9:29931654-29931676 CTGACTTAGGGGAAAGAGGTAGG + Intergenic
1053102667 9:35384140-35384162 CTGGATGAGTAGAAAGAGTCGGG - Intronic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1054856273 9:69902801-69902823 ATGAAATAGGAGAACAAGGCAGG - Intronic
1055287515 9:74745076-74745098 ATGTATTAGGAGAGAGAGACAGG + Intronic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1057477113 9:95412124-95412146 GTGAAGGAAGAGAAAGAGGCAGG + Intergenic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1060692986 9:125681329-125681351 CTGAATTATGGGAAAAAGTCAGG + Intronic
1060956446 9:127644417-127644439 CTGGATTGGTAAAAAGAGGCAGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1203459824 Un_GL000220v1:24525-24547 CTCAATTAAGAGACAGAGCCTGG - Intergenic
1187082723 X:16007979-16008001 CTAAATTTGGAGAATGAGGAAGG + Intergenic
1187502043 X:19846993-19847015 CTGAATCAGCTGTAAGAGGCAGG + Intronic
1190443755 X:50502340-50502362 ATCAATAAGGAGAAAGTGGCTGG + Intergenic
1190732025 X:53232850-53232872 CAGAAGTAGGAGGCAGAGGCAGG + Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192794304 X:74413252-74413274 CTGAGTTAGGAGAATCAGGCAGG + Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1194222749 X:91215568-91215590 CTGAATTAGGACCTAGAGGTGGG + Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1197405696 X:126046250-126046272 CTCAATTAGGAAAATGATGCAGG - Intergenic
1197767156 X:130066761-130066783 TTGAATGGGGAGAAAGGGGCTGG + Exonic
1198260195 X:134958932-134958954 CTAAATTAGGAGGAAGAAGTAGG + Intergenic
1198872545 X:141191452-141191474 ATGAAATTTGAGAAAGAGGCTGG - Intergenic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200559227 Y:4679026-4679048 CTGAATTAGGACCTAGAGGTGGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201236322 Y:11915449-11915471 CTGAATCAGGGCAAAGAGGAAGG - Intergenic