ID: 981216954

View in Genome Browser
Species Human (GRCh38)
Location 4:142181116-142181138
Sequence CATAAGAGCTTGCAAACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981216954 Original CRISPR CATAAGAGCTTGCAAACCTA AGG Intronic
909559041 1:76989310-76989332 GATATGAGCTTGCACAACTAAGG - Intronic
910182687 1:84503464-84503486 CATAGGAGCTAATAAACCTATGG - Intronic
917812323 1:178671515-178671537 CGTAGGAGGTTGCAAACCTCAGG + Intergenic
921486200 1:215718690-215718712 CATAAGCCCTTGCAGAGCTAAGG + Intronic
922969008 1:229718345-229718367 CCTGAGAGCTTACAATCCTACGG - Intergenic
924156552 1:241182594-241182616 CATAAGACCTGGAAAAACTAAGG - Intronic
924795058 1:247287018-247287040 CATAAAAACCTGCAAACCTCAGG + Intergenic
1065304767 10:24357614-24357636 AAAAAGAGCTTGCAAACCTCTGG - Intronic
1069287955 10:66740373-66740395 CATAAAATCTTCTAAACCTAGGG - Intronic
1070841134 10:79488608-79488630 GATCAGAGCTTCCCAACCTATGG + Intergenic
1071427466 10:85573381-85573403 CATGAGAGGTTTCAAACCCAGGG + Intergenic
1072200664 10:93155826-93155848 CATAAGAGTTTTCAAAGTTAAGG - Intergenic
1082983741 11:59147848-59147870 CAAAAGAGCTTGAACACCCAGGG - Intronic
1084479452 11:69410326-69410348 CACAGGAGCATGCACACCTAAGG + Intergenic
1088668938 11:112122347-112122369 CAAAGGAGCCTGCAAGCCTAAGG + Intronic
1093422027 12:18984634-18984656 CATAAGAGTTTTTAAAACTATGG - Intergenic
1097865746 12:64557916-64557938 CATAAGTGATTTCATACCTATGG + Intergenic
1098690510 12:73481730-73481752 CTTAAGGGCTTACAACCCTAAGG - Intergenic
1102739433 12:115193949-115193971 CATAACATCTTGCAAAACTATGG + Intergenic
1109361919 13:61304137-61304159 AACAAGAGCTAGCAAATCTAAGG + Intergenic
1109973268 13:69798259-69798281 AATAAAAGTTTGCAAATCTAGGG + Intronic
1115212646 14:30983175-30983197 TATAAGAGATTGCACACATATGG - Intronic
1115231586 14:31166447-31166469 TGTAAGAACTTGCAAGCCTAAGG + Intronic
1115689484 14:35827938-35827960 CAAAAGAGCGTGAAAACCTTGGG + Intronic
1116683487 14:48008572-48008594 CATAACAGATCACAAACCTAAGG - Intergenic
1118173308 14:63411044-63411066 CCTAAGTGCTTGCAAACCATGGG - Intronic
1118473037 14:66093124-66093146 CCTAAGAGCTTGCCAAGCTGGGG - Intergenic
1118515107 14:66519387-66519409 CATCAGAGCTTGCAAATTGATGG + Intronic
1124903317 15:33844890-33844912 CAGAGGATGTTGCAAACCTATGG + Exonic
1126204817 15:46033934-46033956 CATAAGAATTAACAAACCTAGGG - Intergenic
1126604704 15:50464213-50464235 CATCAGAGGTTGAAAAACTATGG - Intronic
1129955545 15:79633571-79633593 GAAAAGAGCTGGCAAAGCTAGGG - Intergenic
1130314540 15:82783980-82784002 CATCAGAGCTTGCAGAGCTCTGG - Intronic
1132402408 15:101520897-101520919 CTTAAGGGCTTGTAAAACTAGGG - Intronic
1135432476 16:22397279-22397301 CATAAGTGTTGGCAAACCTGTGG - Intronic
1137071743 16:35909904-35909926 CATAAAAACCTGCAAACCTTAGG - Intergenic
1137632399 16:49956177-49956199 CAAAAAAGTTTGCAAACCTTTGG + Intergenic
1140609470 16:76580997-76581019 CATATTTGCTGGCAAACCTATGG + Intronic
1140715883 16:77725030-77725052 CATAAGAGTTTGAGAACATAAGG + Intronic
1156732736 18:40214664-40214686 CATAAGACGTTGCTAACCTTTGG - Intergenic
1159951216 18:74485594-74485616 CAAAAGAGCTTCAAAACATAAGG - Intergenic
1161420884 19:4175380-4175402 GGTAAGAGCTTGGACACCTAGGG + Intronic
1162893544 19:13750888-13750910 ACAAAGAGCTTGCAAACCTGAGG + Intronic
1162984803 19:14262863-14262885 CATAAGATCTTAAAAACCAATGG - Intergenic
1163991463 19:21002689-21002711 CTTAAGGGCTTGCAACTCTAAGG - Intergenic
1167481141 19:49732284-49732306 CCAAAGAGCTCGCAAACCTGTGG + Intergenic
927991989 2:27454367-27454389 CATCAGAGCTGGTAAACCCAAGG - Exonic
933832607 2:86223058-86223080 CATAACAACTTGCAAACCTCAGG + Intronic
935536115 2:104296728-104296750 AAAAAGAGCTTTCAAACTTACGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944291119 2:198006307-198006329 CATGTGTGCTTGCATACCTAAGG + Intronic
1172159060 20:32852514-32852536 CATAAGAGCCTGAAGACATAAGG - Intergenic
1173011234 20:39184566-39184588 TAGAATAGCTTGCAAAACTAAGG + Intergenic
1174684063 20:52436709-52436731 CAGAAGACCTGGCAAACCTGGGG + Intergenic
1175453079 20:59087249-59087271 CAGAAAAGCTTGCCAACCTCTGG + Intergenic
952546138 3:34421393-34421415 CATCATAGCTTACAAACCAAAGG - Intergenic
955221884 3:57029813-57029835 CAGAGGAGTTTGCAAACCTCGGG + Intronic
956607753 3:71090132-71090154 CATTAGAGATTGCAAACTGATGG - Intronic
956681070 3:71781505-71781527 CATAAGGATTTGCACACCTATGG - Exonic
957130030 3:76212274-76212296 CTGAAGAGCTTGCAATCGTATGG + Intronic
957469202 3:80636531-80636553 CATAAGAGACGGCACACCTAGGG + Intergenic
964047465 3:152346786-152346808 CATGAGAGCTTTCCAACCCAAGG - Intronic
964327952 3:155567517-155567539 TATAAGAGCATGCAAAGCCATGG - Intronic
964501465 3:157352959-157352981 GAGCAGAGCTTGCAAACCCATGG + Intronic
965871954 3:173275253-173275275 CATAAAAACCTGCAAACCTTAGG + Intergenic
966486941 3:180481656-180481678 CATTAAAGCTTGCACACCCAAGG - Intergenic
967021049 3:185523251-185523273 CATAATAGCTTTCAAACATGTGG + Intronic
968866395 4:3215369-3215391 CAAAAGAGCTGGCAAAGCAATGG - Intronic
971660357 4:29406760-29406782 CATAATAGCTTTCAAACCAAGGG - Intergenic
971866262 4:32176631-32176653 CAAAAGAGCTTGCAGAACCAGGG + Intergenic
973101846 4:46282022-46282044 CATAGGAGCTTGGAAACATGAGG + Intronic
977604844 4:98973433-98973455 GAAAAGAGCTTAGAAACCTATGG + Intergenic
981216954 4:142181116-142181138 CATAAGAGCTTGCAAACCTAAGG + Intronic
991584702 5:68190062-68190084 AATAAGACCTTACAAACATAGGG + Intronic
994007270 5:94853766-94853788 CATAAGAACTTGGATGCCTAAGG + Intronic
996193124 5:120569943-120569965 CATAAAAGCTTGCAATTCCAAGG + Intronic
996410686 5:123155758-123155780 AATAAGCACTAGCAAACCTAAGG + Intronic
996518165 5:124396606-124396628 CATAAGATATAGAAAACCTATGG + Intergenic
1000254860 5:159527802-159527824 CATAATAGCTTGCAATCCCCTGG - Intergenic
1000420704 5:161035130-161035152 CCTAGGAGTTTGCACACCTAGGG + Intergenic
1008677729 6:53838361-53838383 CATAACAGCATGCAAATTTAAGG - Intronic
1010698374 6:79007876-79007898 GATTAGAGCTTGCCAACCTAGGG + Intronic
1018456098 6:163954166-163954188 CATAAGAGCTTTATAACTTATGG + Intergenic
1019169434 6:170123887-170123909 CAGGAGGGCTTGCAAACCTATGG - Intergenic
1027608819 7:80333798-80333820 CATAAAAGCTTGCAAGTCCAAGG + Intergenic
1033063943 7:138134852-138134874 CATAGGAGCTTTCATCCCTATGG - Intergenic
1034636304 7:152569940-152569962 CAGAAGAGCTGGCAAACCCATGG - Intergenic
1036024461 8:4889636-4889658 CATAAGAGACTGCAAATATAAGG + Intronic
1037345806 8:17899914-17899936 CAGAATAGCTTGCAACCCTGAGG - Intronic
1038164690 8:25074090-25074112 CATTAGAGCATCCAAACCCACGG - Intergenic
1038936958 8:32262877-32262899 CATGAGAGTTTGCCAAGCTAAGG + Intronic
1039220047 8:35320396-35320418 GATAAGAGCTTGGAAGCCTCTGG - Intronic
1040885698 8:52261388-52261410 GTTAAGAGCTTTCAATCCTATGG + Intronic
1041636805 8:60153887-60153909 CATAAAACCTAGAAAACCTAGGG - Intergenic
1042157774 8:65864039-65864061 CATAAAAACCTGCAAACCTTAGG + Intergenic
1055706302 9:79008613-79008635 CTTAAGAGCTTACAACTCTAAGG - Intergenic
1056805797 9:89727736-89727758 CGTAAGTGCTTACAAATCTATGG - Intergenic
1057107678 9:92435439-92435461 GATAACATCTTGCAAAACTATGG + Intronic
1058013366 9:100003507-100003529 CTTAAGAGCAAGCCAACCTATGG - Intronic
1058498593 9:105587977-105587999 CTTATAAGCTTGCAAACCTAAGG - Intronic
1188504296 X:30864716-30864738 TATCAGAGGTTGCAAACCAATGG + Intronic
1188796807 X:34477004-34477026 CAAAAGAGCTTGAATACCCAGGG - Intergenic
1192926491 X:75759710-75759732 CATAAGAGACTTCAGACCTAGGG + Intergenic
1201065540 Y:10091698-10091720 CTTAAGAGCTTACAACTCTAAGG - Intergenic