ID: 981220679

View in Genome Browser
Species Human (GRCh38)
Location 4:142229995-142230017
Sequence GAAACCAAGGTACCACTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981220679 Original CRISPR GAAACCAAGGTACCACTAAC TGG Intronic
900437290 1:2637170-2637192 TAAACAAAGGTACCACTCAAAGG + Intronic
908004807 1:59716965-59716987 GAAACCCAGGTACCTCTCTCTGG - Intronic
910000108 1:82331176-82331198 AAAACCAAGGTACCACCCAAGGG + Intergenic
914457624 1:147850882-147850904 CAAATCAAAGTACCACAAACTGG - Intergenic
917477622 1:175382569-175382591 CATAACAAGGTACCACCAACTGG + Intronic
919598354 1:199591961-199591983 TATACCAAAGTACCACAAACTGG - Intergenic
921129755 1:212209548-212209570 GAGACCAAACTTCCACTAACTGG + Intergenic
923201622 1:231718158-231718180 GAAACCAAGGACCCATTAAGAGG - Intronic
924869837 1:248029163-248029185 GAAACCAAGAAACCTCTAACTGG - Intronic
1068823705 10:61409429-61409451 GAAACCATGGAAACACTTACAGG + Exonic
1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG + Intronic
1074262287 10:111866014-111866036 GAAATCAAGGTATCTCTATCAGG - Intergenic
1078255784 11:9657701-9657723 CATAACAAGGTACCACAAACAGG + Intergenic
1079156481 11:17952850-17952872 GAAGCCAAGGAAACGCTAACAGG - Intronic
1079260573 11:18875378-18875400 CACAACAAGGTACCACAAACTGG - Intergenic
1080420343 11:32104417-32104439 GAAGCCAAGCTACCAATTACGGG + Exonic
1085711994 11:78837570-78837592 GAAGCCAAGGCACCATTTACAGG - Intronic
1094284706 12:28779974-28779996 GAAACTAATGTACCACTGGCAGG - Intergenic
1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG + Intronic
1101405685 12:104426605-104426627 CAAAACAAGTTACCACAAACTGG - Intergenic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1105743251 13:23351137-23351159 GAAAGCAAGGTGTCACTTACTGG + Intronic
1106776436 13:33015057-33015079 GAAACTAAGGCACGACTTACTGG + Intergenic
1107942864 13:45390384-45390406 GAAGCCAAGCTACCAATTACGGG - Intergenic
1109066873 13:57706486-57706508 TATAACAAAGTACCACTAACTGG + Intronic
1109151337 13:58852059-58852081 GAGACCAATGTACCTATAACTGG + Intergenic
1110057104 13:70986898-70986920 GAAACAAAGGCACCACTTAAAGG - Intergenic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1112155712 13:96815065-96815087 GTGACAAAAGTACCACTAACTGG + Intronic
1112840629 13:103573260-103573282 GAAACAAAGGAACCACTCAAAGG - Intergenic
1113794989 13:113051568-113051590 GAATCCAAGGGTCCAATAACGGG + Intronic
1115885175 14:37963151-37963173 GAAACAAATGTACCATTACCAGG - Intronic
1121436447 14:93923672-93923694 GAAACCAAGGCAGCAACAACCGG + Intronic
1122551636 14:102553199-102553221 GAAACAAAGGCTCCACGAACAGG + Intergenic
1128466748 15:67918945-67918967 AAAACGAAGGTACCACTCAAAGG + Intergenic
1129759670 15:78122134-78122156 GAACCCAAGGAGCCCCTAACAGG + Intronic
1133618149 16:7499073-7499095 GAAAACAAAGAACCACAAACTGG + Intronic
1134591700 16:15459792-15459814 GAAATCACAGTAGCACTAACAGG + Intronic
1140032315 16:71348561-71348583 GAGACCCAGGTGTCACTAACTGG + Intergenic
1144100849 17:11941052-11941074 GAATCCAAGGAACCACTGGCAGG - Intronic
1144306686 17:13974848-13974870 AAAACCAAGGTCCCACTAGGAGG - Intergenic
1146373301 17:32278687-32278709 GAAACCAAGGCACCAAGAGCTGG - Intronic
1146460868 17:33045207-33045229 GAATCCTAGGTATCACTAGCAGG + Intronic
1147630342 17:41926377-41926399 GAAACCAGGAAACCACTGACTGG + Intronic
1153264606 18:3257821-3257843 AAAAACAAGGTACTACTAAAAGG + Intergenic
1158694160 18:59688555-59688577 CAAACCAAGGTAACACTCAAGGG + Intronic
1164781226 19:30895174-30895196 GAAACCTAGATACTATTAACCGG - Intergenic
926479563 2:13375095-13375117 GAAACCAAGGTACAATTTTCTGG + Intergenic
929497930 2:42462777-42462799 GAAACCAAGGTTCAATTATCAGG + Intronic
931102275 2:59015548-59015570 GAAACAAAGGCACCACTCAAAGG + Intergenic
934497530 2:94821161-94821183 TAAACCCAGATACCACTAATTGG - Intergenic
935366879 2:102303410-102303432 GAAACCAATGGAGCATTAACAGG - Intergenic
939430284 2:142095982-142096004 AAAACCAAGGTGACATTAACTGG + Intronic
942119726 2:172764939-172764961 CAAAACAAAGTACCACAAACTGG + Intronic
942393591 2:175522600-175522622 AATACCAATGTCCCACTAACTGG - Intergenic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
945560236 2:211330436-211330458 GAAACAAAGGCACCACTCAAAGG + Intergenic
949049103 2:241887758-241887780 GTTAACAAGGTACCACAAACCGG + Intergenic
1170044655 20:12072451-12072473 TAAAACAAAGTACCACAAACTGG - Intergenic
1171183803 20:23110650-23110672 CAAAACAAAGTACCACAAACTGG + Intergenic
1173572238 20:44084966-44084988 CATAACAAGGTACCACAAACTGG - Intergenic
1175499190 20:59437535-59437557 GGAACCAAGTCACCACTATCAGG - Intergenic
1175703133 20:61154971-61154993 GAAACCAAGGTACAGTTCACAGG - Intergenic
1178354149 21:31896607-31896629 GAAACCAAGAAACCACTAGAGGG - Intronic
1179027893 21:37694943-37694965 GAACCCAAGCTACCTCTATCTGG + Intronic
1179366235 21:40760655-40760677 GAAAGCAAGGTTCCTCTACCTGG - Intronic
1181158142 22:20937815-20937837 GAAAGCAAAATACCACTAAATGG - Intronic
1182810385 22:33111229-33111251 GAAACCAAGGTTCCAGAAATGGG - Intergenic
1184838139 22:47036181-47036203 AAAACCAAGGATCCACTATCCGG + Intronic
949426571 3:3923536-3923558 CAAAACAAAGTACCACAAACTGG - Intronic
951140779 3:19156018-19156040 GAACACCAGGTACCACTAAAGGG - Intronic
959810445 3:110612943-110612965 GGAACCAAGATACCACTGTCAGG - Intergenic
960660110 3:120048696-120048718 GGCACCTAGGTACCACAAACAGG + Intronic
967314292 3:188136613-188136635 AAAACAAAGGTTCCACTATCAGG + Intergenic
969185544 4:5471573-5471595 GTAACTAAGTTACCACCAACTGG - Intronic
975099314 4:70494285-70494307 CAAAACAAAGTACCACAAACTGG + Intergenic
978933712 4:114349914-114349936 GAAAGCAGGATAACACTAACTGG + Intergenic
981220679 4:142229995-142230017 GAAACCAAGGTACCACTAACTGG + Intronic
981469725 4:145117981-145118003 GAAACTAGCGTACCACTAAGTGG + Intronic
984805967 4:183752179-183752201 CAAACCTAAGTACCACAAACTGG + Intergenic
986285546 5:6355801-6355823 GAAACCAAGATACCCCTGGCTGG + Intergenic
986576450 5:9218260-9218282 TAAAACAAAGTACCACAAACAGG - Intronic
987617273 5:20292540-20292562 TAAAACAAGGAACCACAAACTGG + Intronic
990920363 5:60958245-60958267 AAAACAAAGGTACCATTAAAAGG - Intronic
991560413 5:67945470-67945492 GTAACAAAAGTACCACAAACTGG - Intergenic
992231657 5:74670212-74670234 AAAACAAAGGCACCACTCACAGG - Intronic
992363076 5:76062535-76062557 CAAATCAAAGTACCACAAACTGG - Intergenic
993363206 5:87003282-87003304 GAAACCAAGCCACCCCCAACAGG + Intergenic
1000018034 5:157295631-157295653 GAAACAAAGTCACCACAAACAGG - Intronic
1001165463 5:169361582-169361604 CAAAACAAAGTACCACAAACTGG - Intergenic
1004498360 6:16186017-16186039 GAAAGCTAGGTGCCATTAACAGG - Intergenic
1007828417 6:44619263-44619285 CATAGCAAGGTACCACAAACTGG + Intergenic
1011111070 6:83837110-83837132 GTAGCCAAGGTATCAGTAACTGG - Intergenic
1011466628 6:87664626-87664648 GAAACCAAGATTCCATTTACTGG + Intronic
1012073054 6:94647634-94647656 GAAAACAAAGTACCACAAATTGG + Intergenic
1015846717 6:137527920-137527942 AAAACGAAGGTACCAATAAATGG - Intergenic
1018409403 6:163527387-163527409 AAAACCAAGGTTCCAATAACAGG - Intronic
1018568190 6:165179625-165179647 AAAACCAAGACACCAATAACAGG + Intergenic
1023104029 7:36746395-36746417 GAAACAGAGGTATTACTAACTGG + Intergenic
1026354483 7:69545656-69545678 GAAACCAAGGTACAGTTAAAAGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1035459224 7:159029070-159029092 CAAACCAAGGTGACACTGACAGG + Exonic
1037998702 8:23371957-23371979 GAAAGAAAAGTACAACTAACAGG + Intronic
1038128026 8:24696328-24696350 ACAAACAAAGTACCACTAACTGG + Intergenic
1046591573 8:116213570-116213592 GAAACTAAGGAACCAGAAACTGG - Intergenic
1047723553 8:127665180-127665202 CATACCAAAGTACCACAAACTGG - Intergenic
1053659614 9:40259310-40259332 TAAACCCAGATACCACTAATTGG + Intronic
1053909985 9:42888662-42888684 TAAACCCAGATACCACTAATTGG + Intergenic
1054371742 9:64405609-64405631 TAAACCCAGATACCACTAATTGG + Intronic
1054524984 9:66116906-66116928 TAAACCCAGATACCACTAATTGG - Intronic
1054679361 9:67895326-67895348 TAAACCCAGATACCACTAATTGG + Intronic
1057349855 9:94287025-94287047 GAAACCAAGGTTCCATTCTCAGG + Intronic
1185994853 X:4934916-4934938 GAAGCCAAGGTACCATGAAAAGG + Intergenic
1190690721 X:52910943-52910965 AAAACAAAGGTACCAGTATCTGG + Intergenic
1190695262 X:52944849-52944871 AAAACAAAGGTACCAGTATCTGG - Intronic
1194805105 X:98317462-98317484 AAAAGCAATGTATCACTAACTGG - Intergenic
1195755422 X:108194596-108194618 GAAACATAGTTACCACTAAGTGG + Intronic
1196287351 X:113898026-113898048 CAAACCAATGTACCTCTTACAGG - Intergenic
1200693905 Y:6339247-6339269 GACACCAGGGAACCACTACCAGG - Intergenic
1200952420 Y:8912455-8912477 GACACCAGGGCACCACTACCAGG - Intergenic
1201041372 Y:9835472-9835494 GACACCAGGGAACCACTACCAGG + Intergenic