ID: 981221119

View in Genome Browser
Species Human (GRCh38)
Location 4:142236291-142236313
Sequence CAGTAGAAGCATAAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981221119_981221121 7 Left 981221119 4:142236291-142236313 CCAAACTCCTTATGCTTCTACTG 0: 1
1: 0
2: 0
3: 11
4: 198
Right 981221121 4:142236321-142236343 TAAGCTTGCTTTATCCTTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981221119 Original CRISPR CAGTAGAAGCATAAGGAGTT TGG (reversed) Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
905007849 1:34725467-34725489 CATTAGTAGAATAAGGGGTTAGG - Intronic
906860375 1:49352869-49352891 TAGTAGCAGCAGATGGAGTTGGG + Intronic
907165750 1:52409307-52409329 CAGTAGAAGGTTAAGAATTTGGG + Intronic
908033558 1:60027764-60027786 TGCTAGAAGAATAAGGAGTTGGG + Intronic
909699298 1:78503663-78503685 CAGAGGAAGCATGTGGAGTTTGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
916746239 1:167686988-167687010 GAGTAAAAGCAGAGGGAGTTAGG + Intronic
1062997007 10:1875283-1875305 CAGTAAAAAGATCAGGAGTTGGG - Intergenic
1065423499 10:25574475-25574497 TAGTAAAAGGATAAGCAGTTTGG + Intronic
1069322273 10:67186868-67186890 TAATAGAAGAATATGGAGTTGGG - Intronic
1070639187 10:78154204-78154226 TAGTAGAAGCATATGGGGTCAGG - Intergenic
1071878482 10:89868357-89868379 AAGTAGAAGCATTATAAGTTGGG - Intergenic
1072541682 10:96402970-96402992 CAGTTGCAGCATAACAAGTTGGG + Intronic
1077979761 11:7287885-7287907 CAATAAAAACATAAGGTGTTTGG - Intronic
1078519891 11:12054184-12054206 CAGTGGGAGAATAAGCAGTTTGG + Intergenic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080117655 11:28638844-28638866 CCGAAGAAGCACAAGGAGTGGGG + Intergenic
1082013275 11:47465482-47465504 AAGTAGAAGCTTAAGAACTTTGG + Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095514505 12:42991114-42991136 GAGTATCAGCATAAGGAGGTGGG - Intergenic
1095609871 12:44114744-44114766 TAGTAGAAGTATAAGGGGTGAGG + Intronic
1096895744 12:54819352-54819374 CACAGGAAGCATAAGGGGTTGGG - Intergenic
1097233994 12:57527622-57527644 CAGCAGAGGGCTAAGGAGTTGGG - Exonic
1099681528 12:85835995-85836017 CAGTCCTAGCCTAAGGAGTTAGG - Intronic
1100561908 12:95755542-95755564 GAGTATAAGCAAAAGGATTTTGG - Intronic
1101122432 12:101597091-101597113 CATTAGAAGAGTAAGGAGTACGG + Intronic
1101381190 12:104215545-104215567 CAGCCGAAGGATAAGGATTTTGG + Intergenic
1102215695 12:111160047-111160069 CAAAAAAAGCAAAAGGAGTTAGG + Intronic
1102447342 12:113013758-113013780 CATTAGAATCATAAGGCTTTTGG - Intergenic
1102668660 12:114598763-114598785 CAGTAGAAGCACAGGGAATTGGG + Intergenic
1102909039 12:116698542-116698564 AAGTAGAAGCAACAGGAATTTGG - Intergenic
1103862972 12:124028932-124028954 CAGAAGGAGCATATGGAATTTGG - Intronic
1106197164 13:27503764-27503786 CACTGGAAGCATAAGAAGTGGGG + Intergenic
1106452132 13:29892178-29892200 CAGAAGAAGAAAAGGGAGTTTGG + Intergenic
1106720827 13:32433154-32433176 CAGCTGAAGGACAAGGAGTTGGG - Intronic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1108561200 13:51646019-51646041 AAGTAGAAGCATCAGGACTTGGG - Intronic
1112153743 13:96794089-96794111 CAGTAGAAACAAAAGTAGTCAGG - Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115617827 14:35113155-35113177 CAGAAGAAACATTAGGAGATGGG + Intronic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1117005717 14:51419116-51419138 CACAGGAAGCGTAAGGAGTTGGG - Intergenic
1117508940 14:56429439-56429461 CTGGGGAAGCTTAAGGAGTTTGG + Intergenic
1117625755 14:57636139-57636161 CAGGAGAACCAGTAGGAGTTAGG + Intronic
1118916059 14:70107303-70107325 CAGTAGATGTATAAGGAGCCTGG - Intronic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121901813 14:97699512-97699534 GAGTAGAAAGATAAGGAGATTGG + Intergenic
1124061319 15:26296198-26296220 CAGCAGAAGCAGAAGAATTTGGG - Intergenic
1126157489 15:45578863-45578885 CAATAGAAGCATAAGGTCATGGG + Intergenic
1126446165 15:48747190-48747212 GACTAGAAGCATAAAGAGTCAGG + Intronic
1126657731 15:50998010-50998032 AAGTAGAAGATTAAGGAGTAAGG + Intronic
1129463452 15:75711363-75711385 CAGTTGAAGCCCAAGGAGGTGGG + Intronic
1129721435 15:77880039-77880061 CAGTTGAAGCCCAAGGAGGTGGG - Intergenic
1135929921 16:26727809-26727831 CGGTAGCAGCAAAAGCAGTTAGG + Intergenic
1137471030 16:48758867-48758889 CCCAAGAAGCATAAGGGGTTGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138760426 16:59537242-59537264 AAATAGAAGCCTAAGGAGTACGG + Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1140819888 16:78653396-78653418 CATTAGAGGCAAAAGGATTTTGG - Intronic
1141295057 16:82760077-82760099 CAATAAAATCATAAGGATTTTGG - Intronic
1141778148 16:86138177-86138199 CAGTGGAAGCCCAAGGAGTAGGG + Intergenic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1144633286 17:16887077-16887099 CAGAAGCAGCATAAGAAGTTGGG + Intergenic
1146036622 17:29412469-29412491 CAGTATAAGCTGAAGCAGTTGGG - Intronic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1150943012 17:69713668-69713690 CAATAGAATAATAAGGAGTTTGG + Intergenic
1151486825 17:74406166-74406188 CAGTGGCTGCATAAGGGGTTGGG + Intergenic
1155698264 18:28710698-28710720 CAGAAGAAGTACAAGGATTTAGG + Intergenic
1158934708 18:62354107-62354129 TAGTAGAAAGATAAGGACTTGGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
928907082 2:36380022-36380044 CATAAGAAGCATATGCAGTTAGG - Intronic
928909079 2:36400498-36400520 CACTTGAAGCATAAGCAATTAGG - Intronic
930159496 2:48139584-48139606 CTATTGAAGCATAAGGAATTCGG + Intergenic
930558194 2:52926806-52926828 CAGTAGAGGCATAAAGAATAAGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
933982912 2:87568124-87568146 CAAGAGAAGCCTAAGGAGATGGG + Intergenic
934934954 2:98458722-98458744 CAGGAGAAACAAAAGGTGTTGGG + Intronic
935526039 2:104168399-104168421 CGGTAAAAGCAAAAGGAGCTAGG + Intergenic
935882199 2:107575855-107575877 CAGCAGAACTATATGGAGTTTGG + Intergenic
936310928 2:111382670-111382692 CAAGAGAAGCCTAAGGAGATGGG - Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
939153653 2:138500922-138500944 CAGTTAAAGCAAAAAGAGTTGGG + Intergenic
939172256 2:138709693-138709715 CAGTAAAAGAATTAGGGGTTGGG - Intronic
939886850 2:147690615-147690637 TGGTAGAAGCAGAGGGAGTTGGG + Intergenic
940265874 2:151836854-151836876 CTGTAGTAGCATTAGCAGTTTGG - Exonic
941774057 2:169372695-169372717 CAAGAGAAGCTTAAGGAGATAGG - Intergenic
945927332 2:215819202-215819224 CTCAAGAAGCACAAGGAGTTGGG + Intergenic
948500743 2:238391683-238391705 CAATAGAAATATGAGGAGTTTGG + Intronic
1170294164 20:14806334-14806356 CTGAAGAAGCACAAGGGGTTGGG + Intronic
1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG + Intergenic
1173036572 20:39417307-39417329 CAGAAGAAGCCACAGGAGTTTGG + Intergenic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1174943290 20:54956115-54956137 CAGGAGAAGCACCTGGAGTTCGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1177042779 21:16133450-16133472 CACGAGAAGCACAAGGGGTTGGG - Intergenic
1182641128 22:31768589-31768611 CAGTAGGTGCTTAAAGAGTTTGG - Intronic
1182897206 22:33868762-33868784 CAGTAAATGCATGATGAGTTGGG - Intronic
1183398956 22:37589831-37589853 CAGCAGGAGCAAAAGGGGTTGGG + Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956364431 3:68484597-68484619 CAGAAGCAGAATGAGGAGTTTGG + Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
957589915 3:82182971-82182993 CAGTAAAAGAATAAAGAGTGAGG - Intergenic
959681198 3:109098500-109098522 CTGGAGATGCATATGGAGTTTGG - Intronic
962446712 3:135472428-135472450 CAGAGGTAGCATCAGGAGTTTGG - Intergenic
963488487 3:145967824-145967846 CAGAGGAAGCTTTAGGAGTTAGG - Intergenic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
965901600 3:173647148-173647170 TATTAGAAGCATAAGCATTTAGG - Intronic
967422509 3:189289362-189289384 CAGTAGGAACAGAAAGAGTTAGG - Intronic
970826182 4:20278880-20278902 CAGAAGAAGAATAAGTATTTAGG + Intronic
971565933 4:28141608-28141630 CAGCAGAAGCAGCAAGAGTTAGG - Intergenic
971751319 4:30652625-30652647 CAGTAGAAGTATTAGTATTTAGG + Intergenic
972582034 4:40403588-40403610 CAGTAGGAGCTTAATAAGTTGGG - Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973272924 4:48279793-48279815 ATCTAGAAGCACAAGGAGTTGGG + Intergenic
974286592 4:59876879-59876901 CAGTCAAAGCCTGAGGAGTTGGG + Intergenic
975381359 4:73703921-73703943 CAGTAAGTGCATAAGGAATTGGG + Intergenic
977129924 4:93223013-93223035 CAGTAGAACCAGGAGGGGTTAGG + Intronic
978150810 4:105432587-105432609 CAGTAGAGGCAGAAGGGGATAGG + Intronic
978712023 4:111794734-111794756 CAATAAAAGTATGAGGAGTTAGG - Intergenic
979824583 4:125217501-125217523 CAGTAAAAGCATTAGGGGTGTGG + Intergenic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982222514 4:153137125-153137147 CACTGGATGCAGAAGGAGTTGGG - Intergenic
982311280 4:153987972-153987994 CAGTAGAAGCACATGGAGACAGG - Intergenic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
984274629 4:177595332-177595354 CAATGGAAGGATATGGAGTTTGG - Intergenic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988677703 5:33450386-33450408 TAGTAGAAGCAGAACCAGTTAGG + Intronic
989337506 5:40336084-40336106 TAGAGGAAGCACAAGGAGTTGGG + Intergenic
990276398 5:54201594-54201616 AAGAAGAAGCATAAGGGGTAAGG - Intronic
990924222 5:61001245-61001267 AAGTAAAAGTATAAGGAGGTTGG - Intronic
991268738 5:64754046-64754068 TAGTAGTAGATTAAGGAGTTTGG - Intronic
992409229 5:76489048-76489070 CAGTGGAAGAACAAGGAGCTGGG - Intronic
993548566 5:89244454-89244476 CTGTAGGAGCACATGGAGTTTGG + Intergenic
994215117 5:97129102-97129124 CATAAGAAGCATAGGGAGTGAGG - Intronic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
994743260 5:103647327-103647349 CATTAGAATCATAAGGCTTTTGG + Intergenic
996363499 5:122676293-122676315 GAGAAAAAGCATAAGGACTTGGG - Intergenic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
997899122 5:137747795-137747817 GAGTAGTAGGCTAAGGAGTTTGG - Intergenic
1000594136 5:163194476-163194498 AAGAAGAAGCATTAGGAGTAAGG - Intergenic
1002940924 6:1715088-1715110 CAGCAGAAACATAAGGAGACAGG + Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007293997 6:40807391-40807413 CCATAGAAGCATCAGGAGTTGGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008403822 6:51096698-51096720 CAGTTGAAAAATAAGGACTTAGG + Intergenic
1011221430 6:85058315-85058337 CAGAAGAAGCAGAAGGGCTTGGG + Intergenic
1014820574 6:125984566-125984588 CAGCAGGAGAATAAGGACTTTGG - Intergenic
1015504251 6:133965385-133965407 AATTAGAAGCATAATGGGTTTGG - Intronic
1016218504 6:141634425-141634447 CAGTCAAAGCAAAAGCAGTTTGG - Intergenic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1017703083 6:157094856-157094878 GAGTAGTGGCAGAAGGAGTTTGG + Intronic
1019873352 7:3788104-3788126 CAATCGAAGCAGAAGGAGTGAGG - Intronic
1021339169 7:19442022-19442044 CAGTTGAAGCATAGGGAAGTTGG + Intergenic
1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG + Intergenic
1022578165 7:31518904-31518926 CAGAAGATGCAAAAGAAGTTGGG + Intronic
1023658748 7:42452241-42452263 AAGTAGAAAAATTAGGAGTTCGG + Intergenic
1024161798 7:46683521-46683543 CAAGAAAAGGATAAGGAGTTTGG + Intronic
1024282587 7:47731716-47731738 CAGCAGAAGCATGATGAGCTAGG - Intronic
1026467138 7:70663784-70663806 CTGTAGAAGGATCATGAGTTTGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028826608 7:95280951-95280973 CAATAGAAGCAGAAAGGGTTTGG - Intronic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031326955 7:120412820-120412842 AAATGGAAGCATTAGGAGTTTGG - Intronic
1032411812 7:131699738-131699760 AGGTAGAAGCATAAGGATGTGGG + Intergenic
1034079064 7:148259821-148259843 CATTAGAAGCATACTGATTTAGG - Intronic
1036639757 8:10575391-10575413 CAGTATATGCATCAGGTGTTTGG - Intergenic
1037354645 8:18004886-18004908 CACTTGAAGACTAAGGAGTTTGG - Intronic
1039565927 8:38552687-38552709 CTTTAGAAGCAGAAGGTGTTAGG - Intergenic
1040546814 8:48404475-48404497 AAGTAGAATCGTAAGAAGTTTGG + Intergenic
1041172302 8:55156542-55156564 AAATAGAAACATAAAGAGTTTGG + Intronic
1044872110 8:96629539-96629561 CCGTAGAAGAAGAAGGGGTTGGG + Intergenic
1046051536 8:109028789-109028811 CAGTTTAAGAATAAAGAGTTGGG + Intergenic
1046307528 8:112389385-112389407 TAGTAGAATAATAAGGATTTTGG - Intronic
1047309307 8:123678163-123678185 CATTAGAGGCAGAAGGACTTGGG + Intergenic
1047414175 8:124650359-124650381 CAGTTGAAGCAACAGGAGTGTGG - Intronic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1050461173 9:5878916-5878938 AAGTTGAAGCTTCAGGAGTTTGG - Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053315277 9:37045884-37045906 CATTAGTAGCATAGGGACTTTGG + Intergenic
1055969598 9:81898685-81898707 CAGTGGAAGTATATGGAGTGTGG + Intergenic
1059521620 9:114947783-114947805 AAATAGTAGGATAAGGAGTTGGG + Intergenic
1188158210 X:26768531-26768553 CAGTGGAACAATAAGAAGTTGGG + Intergenic
1188633025 X:32392181-32392203 AAGTAGATGCATAGGGAGTGAGG + Intronic
1189153562 X:38731731-38731753 CAGTAGGCTCATAAGGACTTTGG + Intergenic
1189283161 X:39833400-39833422 CAGCAGAAGCATAAGAGGTTGGG - Intergenic
1189921440 X:45906674-45906696 CAGCAGAAGCATGAGGATTCAGG - Intergenic
1191711350 X:64152786-64152808 CCCAAGAAGCATAAGGGGTTGGG + Intergenic
1191792004 X:64981007-64981029 TAGTGGAGACATAAGGAGTTGGG + Intronic
1193971509 X:88060766-88060788 CGGTGGAATCATAAGGATTTGGG + Intergenic
1194071987 X:89337157-89337179 CAATGGAAGCAAAAGTAGTTGGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196801257 X:119545403-119545425 AAGTAGAGGCATAATGTGTTAGG - Intronic
1197416535 X:126180993-126181015 CAGTGGAAGGATATTGAGTTGGG - Intergenic
1197456650 X:126684340-126684362 CAGTAGAAGCATAAGGAAAGGGG + Intergenic
1198647246 X:138822809-138822831 CAGTAAAAGCATAATGATTGTGG - Intronic
1199519429 X:148718812-148718834 CAGTAGGAGCATAGTTAGTTAGG + Intronic
1199559023 X:149142916-149142938 CAGAAGAAAAATAATGAGTTTGG + Intergenic
1200215368 X:154365900-154365922 CAGTAGAAGCTCAAAGAGTAGGG + Intronic
1200726231 Y:6672890-6672912 CAATGGAAGCAAAAGTAGTTGGG + Intergenic
1201975075 Y:19840024-19840046 CCTTAGAAGCATAAGGGGTCAGG - Intergenic