ID: 981224768

View in Genome Browser
Species Human (GRCh38)
Location 4:142280824-142280846
Sequence CTGACATTTACTTGGAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981224765_981224768 0 Left 981224765 4:142280801-142280823 CCTCTTCCATGTCAAGCAAATTT 0: 1
1: 0
2: 1
3: 65
4: 1402
Right 981224768 4:142280824-142280846 CTGACATTTACTTGGAATGTTGG 0: 1
1: 0
2: 2
3: 21
4: 210
981224766_981224768 -6 Left 981224766 4:142280807-142280829 CCATGTCAAGCAAATTTCTGACA 0: 1
1: 0
2: 0
3: 24
4: 218
Right 981224768 4:142280824-142280846 CTGACATTTACTTGGAATGTTGG 0: 1
1: 0
2: 2
3: 21
4: 210
981224764_981224768 20 Left 981224764 4:142280781-142280803 CCACATTATTAAAATGTTATCCT 0: 1
1: 1
2: 2
3: 42
4: 415
Right 981224768 4:142280824-142280846 CTGACATTTACTTGGAATGTTGG 0: 1
1: 0
2: 2
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981224768 Original CRISPR CTGACATTTACTTGGAATGT TGG Intronic
900383746 1:2399620-2399642 TTGAAATGTACTTGTAATGTTGG + Intronic
903582920 1:24385640-24385662 CTGACATTTACTAGTTATGTGGG - Intronic
904058571 1:27688297-27688319 TTGACATTTATAGGGAATGTAGG + Intergenic
904405320 1:30284568-30284590 CTAACATTTAGTGGTAATGTGGG + Intergenic
904451206 1:30613271-30613293 CTAAGAGTTTCTTGGAATGTGGG - Intergenic
905809037 1:40898669-40898691 CTGGCATTTGCTTGGTATGTGGG + Intergenic
907759598 1:57344136-57344158 CTGCCATTTACTGGTTATGTGGG - Intronic
908216464 1:61959019-61959041 CTTGAATTTTCTTGGAATGTGGG + Intronic
908950190 1:69551778-69551800 GTGACATTTACATAGCATGTGGG + Intergenic
911055524 1:93705296-93705318 GTGACATTGACTTTGAATGTAGG + Intronic
912102563 1:106229438-106229460 CTGACATTTACTTGGTACAATGG + Intergenic
912262788 1:108125739-108125761 CTGACAGTTACTTGCAATAGTGG + Intergenic
915077354 1:153320132-153320154 CTGAAATTGACCTGGAATGCTGG - Intergenic
916954904 1:169822096-169822118 CTGATATTTACTTGGTGTGTAGG - Intronic
917000556 1:170353314-170353336 CTGACATTTCCTAGGCATCTGGG + Intergenic
918855366 1:189748105-189748127 GAGAAATATACTTGGAATGTTGG - Intergenic
920364204 1:205439569-205439591 CTCCCCTTTCCTTGGAATGTGGG - Intronic
921933547 1:220775372-220775394 ATGACATTTACTTAGAGTGATGG - Intronic
923319001 1:232811362-232811384 CTGTCATTTCCGTGGAATTTTGG - Intergenic
924333807 1:242966863-242966885 CTTACATTCACTAGGAAGGTGGG + Intergenic
1064330842 10:14392523-14392545 CTGACATTAACTTGGGGTCTAGG - Intronic
1069011581 10:63380012-63380034 CTCACATTGACTTGGATTCTTGG + Intronic
1069133421 10:64733857-64733879 CTGACCTTTGCTTGCAATATAGG - Intergenic
1071447803 10:85765011-85765033 CTGATATTTATTTAGAATTTAGG + Intronic
1072646916 10:97263526-97263548 CTGACATTGACTTGGAATCAGGG - Exonic
1072832899 10:98677916-98677938 CTCACATTTACTTATATTGTGGG + Intronic
1072905927 10:99453640-99453662 CTGACACTTATCTGGAAAGTTGG + Intergenic
1074365039 10:112850900-112850922 CTGGCATTTCTTTGGAAAGTTGG - Intergenic
1075219374 10:120571412-120571434 CAGACACTCACTTGGAATGCAGG + Intronic
1076185936 10:128448753-128448775 CTGGGATTTACTTTGTATGTAGG - Intergenic
1076519273 10:131070359-131070381 TTGACATTCACTTGGAAAATTGG + Intergenic
1079643070 11:22830252-22830274 CTGATGTTTACTTGGAATTTTGG - Intronic
1081211465 11:40339921-40339943 CTGACATTTACTTGGAAATTTGG + Intronic
1083004537 11:59330247-59330269 TTATCATTTACCTGGAATGTAGG - Intergenic
1085338268 11:75714087-75714109 CTGACCATTACTTGGACTCTGGG - Intergenic
1086909851 11:92459501-92459523 CTGACAATAACCTGGAAGGTAGG - Intronic
1089189494 11:116643808-116643830 CTGGCATATATTTGGAAAGTGGG + Intergenic
1093198981 12:16164462-16164484 CTGAAAATAACTTGCAATGTTGG - Intergenic
1093396666 12:18691550-18691572 ATGACAATCACTTGGAAGGTAGG + Intronic
1095317830 12:40787749-40787771 ATGACATTCACCTGGAATGTAGG + Intronic
1095710669 12:45284746-45284768 CTATCATTTACTTGGCATGCAGG - Intronic
1096952814 12:55492336-55492358 CTGACATTTACATGTAGTTTTGG + Intergenic
1099225982 12:79969617-79969639 CTGAAATTTACATTGAATGGGGG - Intergenic
1099347410 12:81519825-81519847 CAGACATTTACTGGGGATCTTGG - Intronic
1099385378 12:82006860-82006882 ATGACATTTTCTTGGAATTTGGG + Intergenic
1100661485 12:96703778-96703800 CTGACATTTTCATACAATGTGGG + Intronic
1101009818 12:100437989-100438011 CTGCCATTTACTTGGGACGTTGG - Intergenic
1101271256 12:103147702-103147724 CTGGTGTTCACTTGGAATGTTGG + Intergenic
1103867072 12:124061357-124061379 CTAAAATTTATTTGGAATTTAGG - Intronic
1104896133 12:132164765-132164787 CTGCCATTTACGTGGAATAAAGG - Intergenic
1106058694 13:26264119-26264141 CTGACATTTTCTTGGAAATTAGG - Intronic
1106819361 13:33445919-33445941 CTGAAATTTAATTTCAATGTTGG - Intergenic
1106911888 13:34471827-34471849 CTGACATTTTAGTGGAATTTTGG - Intergenic
1107689670 13:42940301-42940323 ATGTCATTTTCTTGGAAAGTCGG + Intronic
1110098226 13:71559725-71559747 CTGAGATCTATTTGGAATGAGGG + Intronic
1111157705 13:84350212-84350234 ATGACATTTTCTTGGATTATCGG - Intergenic
1114202622 14:20536709-20536731 CTGACATTGACTTGAAGTGGGGG + Intergenic
1114251670 14:20967134-20967156 CAGACATTGGCTGGGAATGTTGG + Intergenic
1114942557 14:27632499-27632521 CTTCCAGTTACTTGGAATTTAGG + Intergenic
1116236482 14:42285377-42285399 CTGAGATTTACCTGGGATGCTGG - Intergenic
1117966392 14:61210952-61210974 ATGGCATTTACTTGGACTTTTGG - Intronic
1118101073 14:62603267-62603289 TTGACATTTACATGGACTATAGG + Intergenic
1118359401 14:65043482-65043504 CTGACTTTTACTTGGCACCTGGG - Intronic
1122646984 14:103201401-103201423 GTGACATTTACATAGCATGTGGG + Intergenic
1125682234 15:41538391-41538413 CTGACATTTACTGTGGATTTGGG - Intronic
1127468537 15:59268991-59269013 TTGAAATGTTCTTGGAATGTGGG - Intronic
1131846479 15:96494859-96494881 CTGACATTTCCTGGGAGAGTGGG - Intergenic
1134173812 16:11990103-11990125 CTCACATCTACCTGGAAGGTGGG - Intronic
1135931019 16:26736768-26736790 CTACTATTCACTTGGAATGTTGG - Intergenic
1137009508 16:35309123-35309145 CTGACTTCTTCTTGGAGTGTAGG - Intergenic
1137262295 16:46841547-46841569 AAGATATTTACTTGGAATGTGGG - Intergenic
1137917082 16:52443702-52443724 GTGACATTTGCTTGGGATATTGG + Intronic
1140623426 16:76763687-76763709 CTGGCATTTACTTCTAATGAAGG - Intergenic
1143254783 17:5547916-5547938 CTTCAATTTCCTTGGAATGTAGG + Intronic
1145851423 17:28102082-28102104 CTGCCTTTTAATTGGAATTTTGG + Intronic
1151785943 17:76275122-76275144 CAGACATTCACAAGGAATGTGGG + Intronic
1154154091 18:11930252-11930274 CTGACAGCTATTTGGGATGTGGG + Intergenic
1156749230 18:40430337-40430359 CTAAACTTTAGTTGGAATGTGGG - Intergenic
1156797790 18:41069337-41069359 CTGACATTTACTTGTCAGGAAGG - Intergenic
1157869456 18:51216401-51216423 CTGACAAATCCTTTGAATGTTGG - Intronic
1158453230 18:57585639-57585661 CTGACACCTACTTGGAGTGGAGG - Intronic
1160075340 18:75669316-75669338 CTGACATTTACTTTTATTGGGGG + Intergenic
1164278219 19:23743011-23743033 CTGATATTTACATAGAATTTTGG + Exonic
1166462098 19:42996584-42996606 CTGACAAATACATGAAATGTGGG + Intronic
925622955 2:5812029-5812051 CTGACTTTATCTTGTAATGTGGG - Intergenic
926951137 2:18244882-18244904 TTGACATTCATTTGGGATGTGGG + Intronic
927004985 2:18839202-18839224 CTGAAATTTACTTGGGATCATGG - Intergenic
927018252 2:18990808-18990830 CTAACACTTACTTGAAATGTTGG + Intergenic
927412301 2:22840780-22840802 CAGACATATAATAGGAATGTTGG + Intergenic
927759675 2:25741619-25741641 CTGACATTTCCTAGGAAGCTAGG - Intronic
928029055 2:27763509-27763531 CTGACATCTATTTTGAATGGAGG + Intergenic
928359590 2:30652470-30652492 ATGACAACTACCTGGAATGTGGG + Intergenic
928512155 2:32011574-32011596 CTGACATTTATGTGGAATACTGG - Intronic
928813414 2:35257275-35257297 TTGAGATTAACTTGGAATTTTGG + Intergenic
929108769 2:38388845-38388867 CAGAGATTTACTTGGAATCAAGG - Intergenic
930231421 2:48847596-48847618 CTGATATATACTGGGAATGCAGG - Intergenic
931097637 2:58959696-58959718 CAGAAATTTACTTGAAATGTAGG + Intergenic
931137891 2:59424781-59424803 ATCACATATACATGGAATGTTGG - Intergenic
931427821 2:62187097-62187119 CTACCACTTAATTGGAATGTTGG - Intergenic
931845170 2:66196225-66196247 CTGACATTTCCTGGGAAAATTGG - Intergenic
933879376 2:86653993-86654015 CTGACTTTTACATGGGTTGTTGG - Intronic
935247620 2:101232952-101232974 ATGACATTTACATAGTATGTGGG + Intronic
935366436 2:102296414-102296436 TTGACTTTTACTTAGAATTTTGG + Intergenic
937500163 2:122469884-122469906 CTGCCATTCATTTGGTATGTGGG - Intergenic
938495995 2:131798438-131798460 CTGATGTTTACCTGGAGTGTAGG + Intronic
938713395 2:133995401-133995423 CTGACATTTACTAGCTGTGTGGG - Intergenic
938791518 2:134680632-134680654 CTGACAGCTACTTTGTATGTTGG + Intronic
939661230 2:144892678-144892700 CTGACATTTCTTTTGTATGTGGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
942068771 2:172296496-172296518 CTGGGAGTTACTAGGAATGTAGG + Intergenic
943034693 2:182727607-182727629 CTGTCTTATACTTGAAATGTAGG + Intronic
944995641 2:205290511-205290533 CTGAAATTTACATGAGATGTAGG + Intronic
945670674 2:212799038-212799060 TTGACATTTCCTTGAAAAGTTGG - Intergenic
1168770872 20:415786-415808 CTGACATTTGCTTGGCTTCTGGG + Intronic
1169933847 20:10862119-10862141 CTGGCTTTTATTTAGAATGTTGG - Intergenic
1170780591 20:19422190-19422212 CTGCCATTTACTGGCCATGTGGG - Intronic
1171208622 20:23300326-23300348 GTGACATTTACATAGCATGTGGG + Intergenic
1173945674 20:46948749-46948771 CTGACAGTTACCTTGAAAGTAGG - Intronic
1175156124 20:56972860-56972882 CTGTCATTTGCTTGGAAGGCAGG - Intergenic
1175773644 20:61639440-61639462 CTGTCATTTCCTTGGTATGCTGG + Intronic
1177062024 21:16387874-16387896 CTGACAGCTACCTGCAATGTTGG - Intergenic
1177095435 21:16826274-16826296 CTGACATCTACTTGGCTTCTGGG + Intergenic
1177911792 21:27041926-27041948 CTGTCATTTATGTGGAATTTTGG + Intergenic
1184827123 22:46959855-46959877 TTGACATTTACTTGGCTTCTTGG + Intronic
949919038 3:8987114-8987136 CAGACATTTACTGTGAATATGGG + Intronic
949951974 3:9236669-9236691 CTGACATCTACTTGGGTTCTGGG - Intronic
952217577 3:31293063-31293085 CTGTGATTTACCTGGAATGTAGG - Intergenic
953314383 3:41912523-41912545 CTACCATTTACTTGGGAGGTGGG + Intronic
958723390 3:97874177-97874199 CTGCCAGTTTCTTGGAATTTAGG - Exonic
959191184 3:103113327-103113349 CTGAGATTTACTTTCAAGGTAGG - Intergenic
961412139 3:126730253-126730275 CTGACAATTATTTGGAATCCAGG - Intronic
963480187 3:145862784-145862806 CTCACATTTACTTAGAAGTTTGG - Intergenic
964039608 3:152243548-152243570 CAGACATTTTCCTGGAATTTGGG - Intergenic
964925591 3:161952806-161952828 CTGTTATTTTCTCGGAATGTTGG - Intergenic
965211852 3:165800783-165800805 CTGACATGTGCCAGGAATGTGGG + Intronic
968386294 4:142050-142072 CTGACATTTTGTTGTAGTGTGGG - Intronic
971401460 4:26279616-26279638 CTTACATTTGCTTTTAATGTAGG + Intronic
971535840 4:27750299-27750321 CTGATGTTTATTTGGCATGTGGG + Intergenic
971555083 4:28003479-28003501 GTGACAGAAACTTGGAATGTGGG - Intergenic
971624185 4:28897584-28897606 CAGACATTTGCTGGGAATGGTGG + Intergenic
971691412 4:29841240-29841262 CTAATATATACTTGGAATTTTGG - Intergenic
971714759 4:30161110-30161132 CTGACATTTAATAGTATTGTGGG - Intergenic
972296641 4:37745605-37745627 CTGGCATTTACTTGGTTTCTGGG + Intergenic
973174294 4:47185347-47185369 CAGAAATTTACTTGGAAGGAAGG - Intronic
975753682 4:77550989-77551011 CTGACATTTACTTTGAGCTTTGG + Intronic
977631974 4:99252955-99252977 CTGACTGTTACTTGAAATGAAGG + Intergenic
978955424 4:114606962-114606984 CTGAAGTTTACTAGGAATATTGG + Intronic
979727516 4:123981451-123981473 TTGACAGTTACTATGAATGTGGG - Intergenic
979742723 4:124171197-124171219 CTGATATTCATTAGGAATGTTGG - Intergenic
980338972 4:131516969-131516991 CTTAAATTTAAGTGGAATGTTGG + Intergenic
981220781 4:142231262-142231284 CTGACATTGAGTGGAAATGTTGG - Intronic
981224768 4:142280824-142280846 CTGACATTTACTTGGAATGTTGG + Intronic
982417275 4:155150508-155150530 CTGACAGTTCCTTGCTATGTGGG + Intergenic
983736834 4:171072237-171072259 GTGACATTTACATAGCATGTGGG - Intergenic
984682485 4:182625584-182625606 CTGACATTTCCTATGACTGTGGG - Intronic
986056867 5:4146758-4146780 CTGGCATTTACTTGTAACGGTGG + Intergenic
986084677 5:4432877-4432899 CTGACATCTGCTTGGATTCTGGG + Intergenic
990291735 5:54359271-54359293 CTGAAGTTTTCTTGGAATTTTGG + Intergenic
990504849 5:56434032-56434054 CTGGCATTTACTTGGCCTCTGGG + Intergenic
990606771 5:57418242-57418264 CTGAAATATATTTGGAATGGAGG + Intergenic
990775367 5:59300452-59300474 CAGACATTAACTCGGAATTTAGG - Intronic
993384499 5:87248110-87248132 CTCAAATTTATTTTGAATGTAGG + Intergenic
994022699 5:95045890-95045912 CTGATATTTTCTTAGAAAGTGGG + Intronic
996019771 5:118578262-118578284 CTGGCACTCACTTGGAATGTAGG + Intergenic
996693762 5:126369962-126369984 CTGAAATTGAGTTGAAATGTTGG - Intronic
996903927 5:128576108-128576130 CTGACATTTTCATGGAGTGATGG - Intronic
998523062 5:142817874-142817896 CTGAAATCTACTTGGAGTTTGGG + Intronic
999194675 5:149773925-149773947 CTGGCATTTCTCTGGAATGTTGG + Intronic
999199850 5:149808136-149808158 CTCACCTTTACTTAGAATTTTGG + Intronic
999926416 5:156383537-156383559 AGGACATTTACTAGGAATATAGG + Intronic
1000830658 5:166097339-166097361 CTGACATTTACTTAAAATTTAGG - Intergenic
1002814728 6:669194-669216 CTGGCATGTAGCTGGAATGTGGG - Intronic
1004045983 6:12023274-12023296 CTTACGTTTACTTGTTATGTAGG + Intronic
1006890540 6:37423885-37423907 GTGACATTTACATAGCATGTGGG + Intergenic
1007685614 6:43665694-43665716 CTGGCATTTCCTGGGCATGTGGG + Intronic
1008244441 6:49152338-49152360 CTCAAATTTCCTTGGTATGTGGG + Intergenic
1010189000 6:73175492-73175514 GTGAGATTTACTTGGAACATTGG - Intronic
1010837899 6:80612493-80612515 CTGAGATTGACATGGGATGTGGG + Intergenic
1011323402 6:86121955-86121977 CTGACATCTACTTGGCTTCTGGG - Intergenic
1012060539 6:94473516-94473538 TTGTCATTTACATGAAATGTAGG + Intergenic
1013106750 6:107032317-107032339 CTGCCATTTAAGTGGAATGTGGG + Intronic
1015623399 6:135156196-135156218 CTGAAATTGACCTGGAATGTTGG - Intergenic
1015854230 6:137606340-137606362 TTGAGATTTACTTGAAATTTAGG + Intergenic
1017860967 6:158396938-158396960 ATGACATTAACTAGGGATGTGGG + Intronic
1018412941 6:163573121-163573143 GTGACATTTATAGGGAATGTTGG + Exonic
1020408322 7:7863144-7863166 CTGTCATTGACTTGGAGTATGGG + Intronic
1020998946 7:15303273-15303295 CTGACATTTAATTAAAATTTAGG - Intronic
1021052295 7:16002656-16002678 CGTTCATTTACCTGGAATGTTGG + Intergenic
1021392358 7:20108757-20108779 CTGAGCTTAACTTGGAATGGTGG + Intergenic
1024783724 7:52881879-52881901 TTGACATGTACTTGAAATATGGG - Intergenic
1025857309 7:65293381-65293403 CTGACATATCTTTGTAATGTTGG + Intergenic
1034370090 7:150587387-150587409 CTGTCATTTACTAGGAATGTTGG + Intergenic
1035488756 7:159253457-159253479 ATGACACTTACTAGCAATGTGGG + Intergenic
1038065627 8:23960873-23960895 CTGACACTTACATGGAATGAAGG - Intergenic
1038121256 8:24618682-24618704 ATGACATTTACATGAAATGTTGG + Intergenic
1038203354 8:25438173-25438195 CTGACATTTTCTAGGCAAGTGGG + Intronic
1038253543 8:25928711-25928733 CTGACATGTATAAGGAATGTTGG - Intronic
1041874542 8:62672870-62672892 ATGACATTTACATGGTATATAGG - Intronic
1041939013 8:63366379-63366401 GTGACATTTACATAGCATGTGGG + Intergenic
1042802255 8:72732322-72732344 CTCACATTCACTTGTAAAGTTGG - Intronic
1042881406 8:73495351-73495373 CTGCCATTTAATTGGAATTGAGG + Intronic
1043129398 8:76442168-76442190 CTGAGATTGACCTGGGATGTTGG - Intergenic
1043483362 8:80674899-80674921 CAGACAGATACTTGGACTGTTGG - Intronic
1044035328 8:87295729-87295751 CTGACATTTAGAAGGAAAGTTGG + Intronic
1044425336 8:92043619-92043641 CTGTAATTTCCTTGGAATTTTGG + Intronic
1045681690 8:104667394-104667416 ATGACATTTACATAGCATGTGGG - Intronic
1046292055 8:112175431-112175453 CAGACGTTTATTTGAAATGTAGG + Intergenic
1049960136 9:730301-730323 TTGACATTAAATTGGAATGCTGG - Intronic
1051591472 9:18780091-18780113 CTGACAATTTCTTTGAGTGTTGG + Intronic
1052533357 9:29716818-29716840 CTGACATTTTCATGGGAAGTTGG - Intergenic
1052700280 9:31929984-31930006 CTGACATTTACAGGGCATGAGGG - Intergenic
1053651311 9:40172775-40172797 CAGACTTTTATTTGCAATGTAGG - Intergenic
1053901703 9:42802128-42802150 CGGACTTTTATTTGCAATGTAGG - Intergenic
1054533269 9:66203428-66203450 CAGACTTTTATTTGCAATGTAGG + Intergenic
1054893392 9:70279073-70279095 TACACATTTAGTTGGAATGTTGG + Intronic
1055601687 9:77925585-77925607 GTGAAATTTACCTGGAATTTAGG - Intronic
1058440001 9:104997984-104998006 CTGGCATTTACTTAGTATGGGGG - Intergenic
1058652922 9:107193914-107193936 CTGGCATCTACTTGGCATCTAGG - Intergenic
1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG + Intronic
1185989481 X:4877058-4877080 GTGACATGTATTTGGAATTTTGG - Intergenic
1187739531 X:22340615-22340637 GGGACATTTACTTGGAATGATGG + Intergenic
1187971809 X:24666267-24666289 CAGACATTTACTAAGCATGTTGG + Intronic
1188093822 X:25997394-25997416 CTGACATTTCCTAGGGATGAAGG - Intergenic
1188709448 X:33376829-33376851 CTGGCATTTCATGGGAATGTTGG + Intergenic
1189495495 X:41504636-41504658 TTGAGATTTACTTATAATGTAGG + Intergenic
1193305526 X:79946241-79946263 CTTACATTTAATTGAACTGTAGG - Intergenic
1193791438 X:85820001-85820023 ATGACATTTACATAGCATGTGGG - Intergenic
1193943282 X:87703072-87703094 TTGACATTTATTTTGAATATAGG - Intergenic
1194919622 X:99749406-99749428 CTGGCATTGGCTTGGAATCTGGG - Intergenic
1196490337 X:116257986-116258008 CTAACATTTATTTGTCATGTAGG + Intergenic
1196607544 X:117673203-117673225 CTGACATTCATTTAGATTGTTGG - Intergenic
1198010985 X:132554033-132554055 GTGAAATTTACTTGGAATCAAGG - Intergenic
1198597525 X:138253089-138253111 ATGACATTTACCTGCATTGTTGG - Intergenic
1199735766 X:150685437-150685459 CTGACATCTACTTGGCAAGCAGG + Intergenic