ID: 981229089

View in Genome Browser
Species Human (GRCh38)
Location 4:142331961-142331983
Sequence CTGGTTATGAGCCTATTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981229089_981229094 4 Left 981229089 4:142331961-142331983 CCCATAAATAGGCTCATAACCAG 0: 1
1: 0
2: 1
3: 3
4: 89
Right 981229094 4:142331988-142332010 TCTGTGTTGAAGTCTAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 134
981229089_981229095 21 Left 981229089 4:142331961-142331983 CCCATAAATAGGCTCATAACCAG 0: 1
1: 0
2: 1
3: 3
4: 89
Right 981229095 4:142332005-142332027 ACTTGGAAAATCATCCATTAAGG 0: 1
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981229089 Original CRISPR CTGGTTATGAGCCTATTTAT GGG (reversed) Intronic
908451048 1:64255286-64255308 CTGGTTCTGAGCTTTTTTTTTGG - Intronic
912970187 1:114274335-114274357 TTGGTCATGAGCCTAATTAGTGG - Intergenic
917164335 1:172095568-172095590 CTGGATTTGAGCCTCTTAATAGG - Intronic
921276625 1:213526956-213526978 CTGGTACTGAGCCAATTCATTGG + Intergenic
1069360424 10:67635191-67635213 CTGGTCATGGGCCTTTTTTTTGG - Intronic
1079824720 11:25176274-25176296 CTGGTTATATGCATTTTTATCGG - Intergenic
1082724760 11:56721378-56721400 CTGGGAATAAGCCTATTTAATGG + Intergenic
1087988013 11:104709060-104709082 CTGGCTATGGGCCTTTTTGTGGG - Intergenic
1089099588 11:115951207-115951229 CTTCTTTTTAGCCTATTTATTGG + Intergenic
1089374588 11:117985759-117985781 CTGGTTAAAAGCCTCTTTCTTGG + Intergenic
1089884933 11:121811126-121811148 TTGGGTATGAGCCTAATAATGGG + Intergenic
1091098832 11:132850349-132850371 ATGTTTATGAGCCTTTTAATGGG - Intronic
1091526289 12:1304610-1304632 CTGGGTGTCAGCCAATTTATTGG + Intronic
1093572519 12:20683331-20683353 TTTTATATGAGCCTATTTATAGG + Exonic
1105691655 13:22846369-22846391 CTGGTTTTGCTCGTATTTATTGG - Intergenic
1109625159 13:64964320-64964342 CTGTTTAGGAGCCTAAATATGGG - Intergenic
1115394890 14:32897336-32897358 CCTGTTATGTCCCTATTTATGGG - Intergenic
1118374680 14:65166553-65166575 CAGGCTAGGAGCCTCTTTATTGG + Intergenic
1120611519 14:86646847-86646869 CTGATTAAGAGCCTATCTCTTGG + Intergenic
1121750040 14:96345360-96345382 CTGGTTCTGAGCCTATGTATTGG - Exonic
1130139730 15:81215449-81215471 CTGGCTATCAGCCTAGCTATTGG - Intronic
1131067978 15:89446212-89446234 CTGGTTAAGATCCTAATGATAGG + Intergenic
1137547866 16:49416572-49416594 TTGGTAATGAGCCTATTCACAGG - Intergenic
1160380686 18:78452908-78452930 CTGTATATGAGTCTGTTTATAGG - Intergenic
1163004899 19:14391017-14391039 CGGGATATGAGCCTGTTTCTGGG + Exonic
1163062770 19:14772382-14772404 CAGGATATGAGCCTGTTTCTGGG - Exonic
1164451987 19:28374236-28374258 CTGGTTCTGAGACCTTTTATTGG + Intergenic
1164499926 19:28810211-28810233 ATAGTTATGACCCTACTTATTGG - Intergenic
926134080 2:10324586-10324608 CTGGTTTTCAGCCTATGTTTTGG + Intronic
927418935 2:22909116-22909138 ATGATTATGTGCCTATTTTTAGG + Intergenic
928963486 2:36953832-36953854 CTGATTATTAGTCTATTTTTAGG - Intronic
929239407 2:39638594-39638616 CTGATTATGAGCCTGGTTCTGGG - Intergenic
935143714 2:100379178-100379200 GTGGTAATGAGGCTATTGATTGG + Intergenic
937442834 2:121931522-121931544 ATGGATATGAGTTTATTTATGGG + Intergenic
939760968 2:146179077-146179099 CTGATTATTAGCTTATTTCTTGG + Intergenic
942961564 2:181835551-181835573 CTGCTTATGATGCTATTAATGGG - Intergenic
944758299 2:202786657-202786679 AAGGGTATGAGCATATTTATAGG - Intronic
945880096 2:215315986-215316008 CTGCTTCTGAGCATATTTTTGGG + Intronic
947266772 2:228291138-228291160 TTGCTTATGAGGCTATTGATAGG + Intergenic
1169851377 20:10055433-10055455 CTGGATATTAGCATATTTACTGG + Intronic
1178028343 21:28494004-28494026 CTGGTTATTACCCAATTTTTAGG + Intergenic
1182443840 22:30379183-30379205 CAGGTTTTGTGCTTATTTATTGG - Exonic
949785895 3:7741409-7741431 CTGCTTATGTGCCAATTTAGTGG + Exonic
953646771 3:44762579-44762601 CTGATTATGAGCTGATTTAATGG + Intronic
954522418 3:51241196-51241218 CTGGATATGAAATTATTTATTGG + Intronic
956737995 3:72253331-72253353 CTGGTTCTGAGTCCATCTATGGG - Intergenic
956954054 3:74316474-74316496 CTGGTTATGTACCTAGTAATGGG - Intronic
960434884 3:117614111-117614133 CTGTTTATTAGCCTAAGTATTGG - Intergenic
961301455 3:125924692-125924714 CTGGTTCTCAGCCTATCTAGAGG - Intergenic
961887016 3:130103166-130103188 CTGGTTCTGGGCCTATCTAGAGG + Intronic
964737511 3:159931737-159931759 CTGGTTATCAGCATTTTTACAGG - Intergenic
964994828 3:162866189-162866211 CTCGTTATGAGCTAATTTATAGG + Intergenic
967621888 3:191643206-191643228 CTGAGTATGAGCCTATCTACTGG + Intergenic
973341644 4:49011516-49011538 CTGGTTATTCGCCCATTAATTGG + Intronic
975233416 4:71961783-71961805 CTTGGCATGAGCCTATTTCTTGG + Intergenic
975770445 4:77715569-77715591 CTGGTTATCACCCTATTTCCTGG + Exonic
980550154 4:134325220-134325242 CTTGTTATGAGACTAAATATGGG - Intergenic
981229089 4:142331961-142331983 CTGGTTATGAGCCTATTTATGGG - Intronic
982858322 4:160414248-160414270 CTGGGTATGAGATTAATTATGGG - Intergenic
983026987 4:162750195-162750217 CTGGATTTGAGATTATTTATAGG - Intergenic
983733734 4:171031176-171031198 CTGCTTTTGAGCTTTTTTATGGG - Intergenic
984001238 4:174248396-174248418 CTGGTGAATAGCCTAGTTATGGG - Intronic
987869266 5:23592096-23592118 CTAGGTATAAGCCTATTAATTGG + Intergenic
998606268 5:143638347-143638369 CTGGTCAGGAGTCTATTTACTGG + Intergenic
999817578 5:155192864-155192886 TTGGTTATGAGCCAATTGGTTGG - Intergenic
1008689635 6:53963366-53963388 CTGATACTGAGCCTATTTACAGG - Intronic
1009391032 6:63144466-63144488 CTTGTTATCAGTCTATTTAGGGG - Intergenic
1010301564 6:74266410-74266432 CTGATTATGAGTCTATTCAAGGG - Intergenic
1010687118 6:78866324-78866346 CTAGTGATGAGCCTAATTAAAGG + Intergenic
1019258126 7:64553-64575 CTGGTCATGAGACTTATTATTGG - Intergenic
1021256921 7:18403850-18403872 CTTGCTATGAGTCTATTTAATGG + Intronic
1024017608 7:45332331-45332353 CTAATAATGAGCATATTTATTGG - Intergenic
1024581990 7:50808090-50808112 CTGGTTATAAGTCTGGTTATAGG + Intergenic
1026445131 7:70477647-70477669 CCTGAGATGAGCCTATTTATAGG + Intronic
1036827992 8:11993848-11993870 CTGGTTTTTAGCATTTTTATAGG - Exonic
1037470161 8:19200789-19200811 CTGCTCATGTGGCTATTTATGGG - Intergenic
1038424340 8:27454657-27454679 CTGCTTATGAGCCTCATTAGAGG + Intronic
1042631938 8:70827739-70827761 CTGCTTATGAATGTATTTATTGG + Intergenic
1042923774 8:73945629-73945651 CTGATTATGGGTATATTTATTGG + Exonic
1046703945 8:117429631-117429653 CTGTTTATTTGCTTATTTATAGG - Intergenic
1050084154 9:1947067-1947089 CTGGCTGTGAGCCCTTTTATGGG + Intergenic
1052982484 9:34459031-34459053 CTGCTTATGAGGCTGTTTATGGG - Exonic
1053192096 9:36080837-36080859 CTGAAAATGGGCCTATTTATTGG - Intronic
1055234828 9:74108147-74108169 CTGGTTACTTGCCTATTTATAGG + Intergenic
1057800952 9:98191440-98191462 CTGGAGATGAGCATATTTAAGGG + Intronic
1058272279 9:102987015-102987037 CTAATTATGACCGTATTTATAGG - Intergenic
1058387692 9:104458275-104458297 CTGATTATTAGAGTATTTATAGG + Intergenic
1058540967 9:106012230-106012252 GTGGTTGTGAGCCTCTTTTTTGG - Intergenic
1059858584 9:118430467-118430489 ATGGTTATGGGTCTATTTCTGGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190523316 X:51302136-51302158 CTGTTTATGTGTATATTTATAGG - Intergenic
1196919937 X:120575311-120575333 CTGGTTATGTACCTGGTTATGGG - Intronic
1197325550 X:125089331-125089353 CTGGGTTTAAGACTATTTATTGG + Intergenic
1199553787 X:149084313-149084335 CTGGTTATGAACTTTTTTGTTGG - Intergenic