ID: 981230035

View in Genome Browser
Species Human (GRCh38)
Location 4:142341948-142341970
Sequence CTATAGTCAAGGTGTTGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981230035_981230038 -7 Left 981230035 4:142341948-142341970 CCCGTTCAACACCTTGACTATAG 0: 1
1: 0
2: 3
3: 25
4: 225
Right 981230038 4:142341964-142341986 ACTATAGCCTTGTGAGACTCTGG 0: 1
1: 0
2: 3
3: 14
4: 102
981230035_981230041 0 Left 981230035 4:142341948-142341970 CCCGTTCAACACCTTGACTATAG 0: 1
1: 0
2: 3
3: 25
4: 225
Right 981230041 4:142341971-142341993 CCTTGTGAGACTCTGGGCAGAGG 0: 2
1: 2
2: 33
3: 93
4: 384
981230035_981230042 23 Left 981230035 4:142341948-142341970 CCCGTTCAACACCTTGACTATAG 0: 1
1: 0
2: 3
3: 25
4: 225
Right 981230042 4:142341994-142342016 ACTGTGCTAAGACTAAGTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 84
981230035_981230039 -6 Left 981230035 4:142341948-142341970 CCCGTTCAACACCTTGACTATAG 0: 1
1: 0
2: 3
3: 25
4: 225
Right 981230039 4:142341965-142341987 CTATAGCCTTGTGAGACTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981230035 Original CRISPR CTATAGTCAAGGTGTTGAAC GGG (reversed) Intronic
900910777 1:5595693-5595715 TTAAAGTCAAGGTGTTGGCCGGG - Intergenic
902157138 1:14497754-14497776 CAATAGTCAATATGTTGATCGGG - Intergenic
902647059 1:17806923-17806945 CTACAGTCAAGGTGTTGTCAGGG + Intronic
902666162 1:17940087-17940109 CTAAAGTCAAGGTGTTGACAGGG + Intergenic
903798532 1:25948786-25948808 CTACAGTCAAGGTTGAGAACCGG - Intergenic
904466113 1:30708397-30708419 CTATAGTGAAGGTGTACAGCGGG - Intergenic
904916265 1:33972698-33972720 CTACAGTCAAGGTGTTGGCAGGG - Intronic
905729771 1:40289074-40289096 CTATAATCAATTAGTTGAACAGG - Intronic
911278020 1:95887779-95887801 ATATACTCATGGTGTTCAACAGG - Intergenic
912603933 1:110968401-110968423 CTGCAATCAAGGTGTTGATCAGG + Intergenic
913511615 1:119567774-119567796 CTAGAGTCAGGGTGTTGGAGTGG - Intergenic
913515850 1:119605101-119605123 CTAGAGTCAGGGTGTTGGAGTGG - Intergenic
914349502 1:146828030-146828052 CTAAAATCAAGGTGTTGGAAGGG + Intergenic
916602228 1:166304342-166304364 CCAAAGTCAAGATGTTGACCAGG + Intergenic
917011209 1:170473738-170473760 CTAAAATTAAGGTGTTGAATGGG - Intergenic
917359775 1:174162493-174162515 CTATATTGAAGGTGTAGAAGTGG + Intronic
918391919 1:184074357-184074379 CTACAGTCAAGGTGTTGGGCAGG + Intergenic
919007736 1:191921451-191921473 CTATAGAAAAGGTGTAAAACAGG + Intergenic
920710738 1:208292453-208292475 CTGCAGTCAAGGTGTTGACCAGG - Intergenic
920957086 1:210629603-210629625 CTAAAGTCAAGGTGTTGGCAAGG + Intronic
921503840 1:215942042-215942064 CTGCAGTCAAGGTGTTGGCCAGG + Intronic
921745327 1:218733782-218733804 CTATAGTCAACGTGTTGGCTAGG - Intergenic
922017351 1:221664055-221664077 CTGAAGTCAAGGTGTTGACAGGG - Intergenic
922591658 1:226781964-226781986 CTAAAGTCAAGGTGTTGCCACGG + Intergenic
923435683 1:233965719-233965741 CTATAATCAAGGTATTGACCAGG - Intronic
923845247 1:237722758-237722780 ATATAGTTAAGGTGTCCAACAGG + Intronic
924468927 1:244322456-244322478 CTGTAGTCAATGTGTTGGCCAGG - Intergenic
1064336043 10:14442326-14442348 ATAAAGTCAAGGTATTGACCAGG - Intronic
1065619724 10:27568780-27568802 CTAAAATCAAGGTGTTGACAGGG + Intergenic
1065620771 10:27578622-27578644 CTACATTCAAGGTGTTGGCCAGG - Intergenic
1066227677 10:33400104-33400126 CTACAGTCAAGATATAGAACAGG + Intergenic
1067211893 10:44266380-44266402 CTGAAGTCAAGGTGTTGGCCTGG - Intergenic
1067800013 10:49352440-49352462 CTGCAGTCAAGCTGTTGACCTGG + Intergenic
1069132029 10:64717768-64717790 CTAAAGTCAAGGTGTTGGCATGG + Intergenic
1071465897 10:85939422-85939444 CTAAAATCAAGGTGTTGACAGGG + Intronic
1071862901 10:89693569-89693591 CTATATCCAAGGTGTTTAAAAGG - Intergenic
1072513502 10:96152668-96152690 ATATAGTCAAAGTGTGTAACAGG - Intronic
1072952268 10:99858116-99858138 CTAAAGTCAAGGTGTTGGCAGGG - Intergenic
1074311072 10:112323841-112323863 CTAAAGTCAAGGTGTTGTCAAGG - Intergenic
1076384556 10:130047018-130047040 CTATAATCCAGGTGTTTCACTGG + Intergenic
1077460412 11:2706438-2706460 CTGCAGTCAAGGTGTAGACCAGG - Intronic
1080136937 11:28865944-28865966 CTAAAATCAAGGTGTTGGAAAGG - Intergenic
1081598032 11:44472794-44472816 CTAAAGTCAAGGTGTTGGTGGGG - Intergenic
1084413555 11:69017538-69017560 CTAAAGTCAAGGTGTTGGCAGGG - Intergenic
1085373774 11:76038945-76038967 CTAAAATCAAGGTGTTGGCCAGG - Intronic
1086903978 11:92398024-92398046 CTAAAATCAAGGTGTTGAGAGGG + Intronic
1087254754 11:95940946-95940968 CTGAAATCAAGGTGTTGGACAGG + Intergenic
1087720094 11:101653308-101653330 CTACAGTCAAGCTGTTGGTCAGG - Intronic
1089081828 11:115782545-115782567 CTGTAGTCAAGGTGTTGTCTGGG - Intergenic
1090022976 11:123143780-123143802 CTATAGTCAAGGTGTTGGCAAGG - Intronic
1090195996 11:124817239-124817261 CTAAAGTCCAGGGGGTGAACAGG + Intergenic
1092583463 12:9873518-9873540 CTCTAGTCTTGGTGTTGAAGAGG - Intergenic
1093994662 12:25628798-25628820 CTAAAGTCAAGGTGTTGGCAGGG - Intronic
1094435103 12:30412732-30412754 CTACAATCAAGGTGTTGGTCAGG + Intergenic
1097347948 12:58515934-58515956 CTAAAATCAAGGTGTTGGAAGGG + Intergenic
1098769091 12:74530005-74530027 CTTAAGTCAAGCTGTTAAACTGG - Intergenic
1101334111 12:103781317-103781339 TCAGAGTCAAGCTGTTGAACTGG - Intronic
1103019876 12:117525398-117525420 CTACAGTGAAGGTGCTGAAAGGG + Intronic
1104640303 12:130462883-130462905 CTACAATGAAGGTGTGGAACAGG + Intronic
1107202564 13:37739049-37739071 TTAGAGGCAAGGTGTTCAACTGG + Intronic
1107260699 13:38487359-38487381 CTGCAGTCAAGGTGTTGGCCAGG + Intergenic
1107765891 13:43734138-43734160 CTAAAATCAAGGTGTTGAGAGGG - Intronic
1108966868 13:56318176-56318198 TTATAGTCAAGCTGTGGAACAGG - Intergenic
1109708811 13:66136738-66136760 CTATAATCAAGGTATTTGACAGG + Intergenic
1109724034 13:66315973-66315995 CTAAAGTCAAGGTGTTGAGAGGG + Intronic
1110565520 13:76953945-76953967 TTATATTCAAGGTTTTGAATTGG - Intronic
1111676487 13:91395208-91395230 CTATAACCAAGGTGTTCAGCAGG + Intergenic
1111879119 13:93932927-93932949 CTAAAGTCAAGGTGTTAACAGGG + Intronic
1114763792 14:25347975-25347997 CTAAAGTCAAGGTGTTGGCAGGG + Intergenic
1115727766 14:36235640-36235662 CTATAGTCAAGGTGCAGTATGGG + Intergenic
1116770436 14:49121112-49121134 ATACAGTCAAGGTGTTGGCCTGG - Intergenic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1121720273 14:96104346-96104368 CTAAAGTCAAGGTGTTGGTGGGG - Intergenic
1121727596 14:96164641-96164663 CCAAAATCAAGGTGTTGACCAGG - Intergenic
1121793612 14:96717838-96717860 CTAAAGTCAAGGTGTTGATGGGG + Intergenic
1123463061 15:20492281-20492303 CTGTAGTCAAGGTGTTGGCTAGG - Intergenic
1123655000 15:22508133-22508155 CTGTAGTCAAGGTGTTGGCTAGG + Intergenic
1124273903 15:28309684-28309706 CTGTAGTCAAGGTGTTGGCTAGG - Intronic
1124308908 15:28603334-28603356 CTGTAGTCAAGGTGTTGGCTAGG + Intergenic
1124341507 15:28892511-28892533 CTATAGCCAAGGTGTGGAGTAGG + Intronic
1125245389 15:37630769-37630791 CTATAGTCAAGGGATTGAACAGG - Intergenic
1128078911 15:64844672-64844694 CTATAGTAAAGGGGTTGAGGGGG + Intronic
1130320481 15:82837012-82837034 CTAAAATCAAGGTGTTGACAGGG + Intronic
1130328151 15:82897852-82897874 CTGTAATCAAGGTGTTGACCAGG - Intronic
1130848028 15:87765719-87765741 CTGTAGTTAAGGTGATGACCAGG - Intergenic
1131211575 15:90502275-90502297 CTCTAGTCAAGGTGTTTAGCAGG - Intergenic
1132562914 16:606541-606563 CTGAAGTCAAGGTGTTGGCCAGG + Intronic
1133858421 16:9571712-9571734 CTAAAATCAAGGTGTTGGAAGGG + Intergenic
1134870100 16:17644846-17644868 CTAAAGGCAAGGTGTTGACAGGG - Intergenic
1135287979 16:21210454-21210476 CCACTGTCAAGGTGTTGACCTGG - Intronic
1136009108 16:27351082-27351104 CTATAATCAAGGTGTGGGATGGG + Intronic
1136275498 16:29177204-29177226 CCATCTTCATGGTGTTGAACAGG - Intergenic
1137893001 16:52181888-52181910 CTAAAGTCAAGGTGTTGGCAGGG + Intergenic
1139145065 16:64313675-64313697 CTATAGGCAAAATGTTGTACAGG + Intergenic
1139984535 16:70887524-70887546 CTAAAATCAAGGTGTTGGAAGGG - Intronic
1140723400 16:77790122-77790144 CTGTTCTCAAGGTGGTGAACGGG - Intronic
1142079857 16:88143269-88143291 CCATCTTCATGGTGTTGAACAGG - Intergenic
1146202618 17:30873093-30873115 TTCTAGTCAAGGTATAGAACTGG - Intronic
1148926629 17:51092073-51092095 CTATAGTCAAAGTATTTAAATGG - Intronic
1150328720 17:64277375-64277397 CTATAGCCAAGTTCTTGAAAAGG - Intergenic
1151874476 17:76859064-76859086 CTAAAGTCAATGTGTTGGCCGGG + Intergenic
1152174646 17:78779791-78779813 CTAAAGCCAAGGTGTCGGACAGG - Intronic
1153500912 18:5748978-5749000 CTATAACCAAGGTGTTGGGCAGG - Intergenic
1154312243 18:13276452-13276474 CTGTAGTCAAGGTGTTGGCCAGG + Intronic
1155409147 18:25523065-25523087 CCAGAATCAAGGTGTTGACCAGG - Intergenic
1155568984 18:27169102-27169124 CTACAGTCAAGCTGTTGACTGGG - Intronic
1155571582 18:27200638-27200660 CTGAAATCAAGGTGTTGATCAGG + Intergenic
1156814579 18:41294462-41294484 CTATAATCAAGGTGATGTTCTGG + Intergenic
1157041361 18:44043475-44043497 CTATAATCAAGTTATTGACCAGG + Intergenic
1159659413 18:71075469-71075491 TTATAGTCAAGGTGTTGACTGGG - Intergenic
1160913287 19:1484624-1484646 GTAGAGACAAGGTGTTGACCAGG - Intronic
1162720691 19:12660709-12660731 CTATAATCAAGGTGTTGGCAAGG - Intronic
1166287576 19:41841325-41841347 GTATAGACAAGGTGTTGCCCAGG - Intronic
931341712 2:61408230-61408252 TTTTAGTCAAGGTGTTGGCCAGG - Intronic
932378317 2:71258323-71258345 CTATAATCAAGGTGCCGACCGGG + Intergenic
933024979 2:77244945-77244967 CTTTAATCAAGGTGTTGACTAGG - Intronic
933322436 2:80794096-80794118 TTATAATCAAAGTGTTGGACAGG - Intergenic
934127613 2:88913706-88913728 CTGCAGTCAAGGTGTTGACCAGG - Intergenic
934926703 2:98386940-98386962 CTAAAATCAAGGTGTTGACAGGG - Intronic
936579641 2:113686937-113686959 CTATAGTCTAGGTGTGTAGCAGG + Intergenic
937327648 2:121001037-121001059 CTCCAGGCAAGGTGATGAACAGG + Intergenic
937706879 2:124931252-124931274 CTATGTTCATGTTGTTGAACGGG + Intergenic
939643755 2:144671408-144671430 CTACAATCAAGGTGTTGGCCAGG + Intergenic
941390691 2:164910488-164910510 TTATAGTCAAGGTAGAGAACTGG + Intronic
944675269 2:202030205-202030227 GTATAATCAGGGTGTTGATCAGG - Intergenic
946975295 2:225141718-225141740 TTATAGTCAAAGTGCTGAAGGGG + Intergenic
947945679 2:234100117-234100139 CTACAGTCAAAGTGTTGGCCAGG + Intergenic
948064640 2:235067966-235067988 CTGTAGTCATGGTGTTGCCCAGG - Intergenic
948233773 2:236371293-236371315 CTGTTGTCAAGGTGTTAAAAAGG + Intronic
1170340718 20:15323921-15323943 ATAAAGTCAAGGGGATGAACTGG - Intronic
1171429301 20:25070692-25070714 CTATAGTCACAGTGTTATACAGG - Intergenic
1172714438 20:36952122-36952144 AAACAGTCAAGGTGCTGAACTGG + Intergenic
1173451466 20:43167887-43167909 CTGTAGTCAAGGTGTTGGCCAGG - Intronic
1173908323 20:46645023-46645045 CTAAAGTCAAGGTGTTGGCCAGG + Intronic
1175942300 20:62543128-62543150 CTAAAGTCCATGTGTTGAAAGGG + Intergenic
1178049264 21:28730490-28730512 CTATAATCAAGGTGTTGGCCAGG + Intergenic
1178605562 21:34033750-34033772 CTAAAGTCAAGGTGTTGGCAGGG - Intergenic
1178733520 21:35128473-35128495 TTCCAGTCAAGGAGTTGAACAGG + Intronic
1182883428 22:33753459-33753481 CTAAAGTCAAGGTGTTGGCAAGG - Intronic
949438553 3:4055830-4055852 CTATAATCAAGGTGTTGGCAAGG + Intronic
951565594 3:24009793-24009815 CTATAGTCACTATGTTGTACAGG + Intergenic
953480818 3:43250498-43250520 CTATACTCACTGTGTTGAAAAGG + Intergenic
955057157 3:55465071-55465093 CTAAAGTCATGGTTTTAAACTGG + Intergenic
956106924 3:65829077-65829099 CTAAAATCAAGGTGTTGAAAGGG - Intronic
956145558 3:66187730-66187752 TCATAGTCAAGGTGTTGGTCAGG - Intronic
958642933 3:96831861-96831883 CTACATTCCAGGTGTTGCACTGG - Intronic
959267081 3:104156237-104156259 CTAAAATCAAGGTGTTGACAGGG - Intergenic
959590644 3:108076081-108076103 CTAAAATCAAGGTGTTGCCCAGG - Intronic
960022900 3:112975573-112975595 CTAAAATCAAGGTGTTGGAAGGG + Intergenic
960790947 3:121430322-121430344 CTAGAGTCAAGGTGTTGGCGGGG + Intergenic
961669240 3:128517047-128517069 CTAAAGTCAAGGTGTTGGGGTGG - Intergenic
962934904 3:140071359-140071381 CTAAAGTAAAGGTATTGAACAGG - Intronic
963128139 3:141834016-141834038 CTAAAGTCAAGGTGTTGGCTGGG - Intergenic
965099056 3:164273719-164273741 TTATAGTCAAGATGCTGGACTGG + Intergenic
965146376 3:164910935-164910957 CTAGAGTCAAGGAGATCAACTGG - Intergenic
967950049 3:194833631-194833653 CTGTAGTCAAGGCGTTGGCCAGG - Intergenic
968805067 4:2766946-2766968 CTAAAGTCAAGGTGTTGGCAGGG - Intergenic
971380434 4:26092278-26092300 CTATATTCAAGGAGTAGACCAGG + Intergenic
971454942 4:26835338-26835360 CTAAAATCAAGGTGTTGGAATGG - Intergenic
972758222 4:42073593-42073615 CTGTAATCAAGGTGTTGACTGGG + Intronic
976179400 4:82384823-82384845 CTAAAGTTAAGGTATTGATCAGG + Intergenic
976312896 4:83630027-83630049 CTGTAGTCAAGGTGTTGGCCTGG - Intergenic
976400681 4:84603321-84603343 CTGGAGTGAGGGTGTTGAACTGG - Intronic
977099791 4:92796246-92796268 CAATACTTAAGGTGTTGAAGTGG - Intronic
977587786 4:98793900-98793922 TTACAGTCAAGGTGTTGGTCAGG - Intergenic
977878990 4:102182797-102182819 CTAAAGTCAAGATGTTGGCCAGG - Intergenic
979428898 4:120602968-120602990 CTAAAATCAAGGTGTTGACAAGG + Intergenic
981230035 4:142341948-142341970 CTATAGTCAAGGTGTTGAACGGG - Intronic
981806260 4:148718757-148718779 TTATAGTCAAGTTGTTGGTCAGG - Intergenic
982391481 4:154869034-154869056 CTACAGGGAAGGAGTTGAACAGG - Intergenic
985925404 5:3012198-3012220 CTGTAGCCAAGGTGTTGTCCAGG + Intergenic
986518606 5:8590252-8590274 CCACAGCCAAGGTGTTGACCAGG + Intergenic
986704464 5:10443700-10443722 CTAAAATCAAGGTGTTGACAGGG + Intronic
988099420 5:26658373-26658395 CTACAGTCAAAGTGTTGGAGAGG - Intergenic
988593568 5:32570067-32570089 CTAAAGTCAAGGTGTTGGCAGGG - Intronic
990299032 5:54432315-54432337 TTACAGTCAAGGTGTTGTCCAGG + Intergenic
992466045 5:77005962-77005984 CTACAGTCAAGGTGTTGATAGGG - Intergenic
992654846 5:78898681-78898703 CTAATGTCAAGGTGTTGAGAGGG + Intronic
992876777 5:81064095-81064117 CTACAATCAAGGTGTTGGCCAGG + Intronic
996102908 5:119463272-119463294 CAATAGTCAAGATATGGAACCGG - Intronic
997757989 5:136418495-136418517 CTCAAGTCAAGCTGTTGACCGGG + Intergenic
998069631 5:139187144-139187166 CTATAATAAAGGTGTTGCAATGG + Intronic
999717101 5:154370156-154370178 TTGAAGTGAAGGTGTTGAACTGG + Intronic
1000736182 5:164903389-164903411 TTACAGTCAAGGTGTTAATCAGG + Intergenic
1001304202 5:170559890-170559912 ATGTGGTCAAGGTGTTGAAATGG - Intronic
1001316266 5:170643271-170643293 CTAAAGTCAAGGTGTTGGCCAGG - Intronic
1001809213 5:174614441-174614463 CTGCAGTCAAGGTGTTGACAGGG + Intergenic
1002798791 6:500868-500890 CTATAATCAACCTTTTGAACGGG + Intronic
1005497021 6:26396670-26396692 CAAAAGTCAAGGTGTTGGCCAGG + Intergenic
1005501826 6:26435484-26435506 CAAAAGTCAAGGTGTTGGCCAGG + Intergenic
1005520728 6:26598378-26598400 CTATCTTCAAAGTGTGGAACGGG + Exonic
1007892592 6:45309841-45309863 ATATAGTCAAAGTGATGAAAAGG + Intronic
1008415799 6:51238812-51238834 CTGTAATCAAGGTGTTGGTCAGG - Intergenic
1009548310 6:65051610-65051632 CTATAGTCATCATGTTGTACAGG + Intronic
1011007875 6:82668156-82668178 CTATGGTAAAGGAATTGAACTGG - Intergenic
1011333211 6:86233498-86233520 CTAAAGCCAAGGCCTTGAACTGG + Intergenic
1015574436 6:134656320-134656342 CTAAAGTCAAGGTGTTTACAAGG - Intergenic
1015766911 6:136728484-136728506 CTATCATCAAGGTCTTGAACTGG + Intronic
1015985718 6:138882251-138882273 CTACAGTGAAGAGGTTGAACTGG + Intronic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1016701153 6:147055689-147055711 CTAAAATGAAGGAGTTGAACTGG - Intergenic
1017945112 6:159090235-159090257 CTGCAGTCAAGGTGTTAGACAGG - Intergenic
1020975753 7:15003955-15003977 CTACAGTCAAGGTGTTGACAGGG + Intergenic
1021629362 7:22629312-22629334 CTAAAGTCAAGGTGTTGGCAGGG - Intronic
1022491754 7:30825902-30825924 CTAAAGTCAAGGTGTTGAAAGGG + Intronic
1024098192 7:46003086-46003108 CTATAATCAAGGTGTTGGCATGG - Intergenic
1027536657 7:79411563-79411585 CTAAAATCAAGGTGTTGACAGGG - Intronic
1028386333 7:90258346-90258368 CTAAAGTCAAGATGTTGACAGGG + Intronic
1029946522 7:104539098-104539120 CTAAAATCAAGGTGTTGACAGGG - Intronic
1030284434 7:107811315-107811337 CTAAAATCAAGGTGTTGACAGGG + Intergenic
1031064636 7:117091844-117091866 CTATAATCAAGGTGTTGACCAGG + Intronic
1031915455 7:127558852-127558874 CTAAAATCAAGGTGTTGACAGGG - Intergenic
1032123369 7:129172958-129172980 CTGAAATCAAGGTGTTGACCAGG + Intergenic
1032181311 7:129681269-129681291 CTAAAGTCAAGGTGTTGGCAGGG - Intronic
1034189621 7:149204032-149204054 TTACAGTCAAGCTGTTGAATGGG + Intronic
1034969602 7:155410834-155410856 CTAAGGTCAAGGTGTTGGCCAGG + Intergenic
1038962377 8:32536177-32536199 CTGAAATCAAGGTGTTGACCGGG + Intronic
1041303282 8:56435049-56435071 CTATAGTCAGGGTGATGGATAGG + Intergenic
1042665847 8:71204900-71204922 CTATATGCCAGGTTTTGAACTGG - Intronic
1045100684 8:98840861-98840883 CTTTAGTCAAGGTGATGGCCAGG + Intronic
1045529769 8:102973551-102973573 CTAAAGTCAGGGTCTTGGACAGG + Intronic
1046376853 8:113394826-113394848 CTATAATCAAGGTGTTAATAAGG + Intronic
1046521065 8:115327038-115327060 CAATAGTCAAGGAATGGAACAGG + Intergenic
1047188398 8:122656244-122656266 CTACAGTCAAAGTGTTGGCCAGG - Intergenic
1048773257 8:137918643-137918665 CTAAAGTCAAGGTGTTTACAGGG - Intergenic
1050080373 9:1909457-1909479 TTATAGTCTAGGTCTAGAACAGG + Intergenic
1050916916 9:11147950-11147972 GTATCTTGAAGGTGTTGAACCGG + Intergenic
1051339936 9:16101886-16101908 CCAAAGTCAAGGTGTTGGCCAGG - Intergenic
1052467722 9:28851204-28851226 CTAAAATCAAGGTGTTGAAATGG + Intergenic
1053471644 9:38350658-38350680 CTAAAGTCAAGGTGTTGGCAGGG + Intergenic
1054746158 9:68855996-68856018 CTAAAATCAAGGTGTTGACAAGG + Intronic
1055330864 9:75182009-75182031 TTATAATCAAGGTGTTCAGCTGG - Intergenic
1055331403 9:75187719-75187741 CTAAAGTCAAGGTGTTGGCGTGG - Intergenic
1056898894 9:90580433-90580455 CTGCAGTCAAGGTGTTGGCCGGG + Intergenic
1058762320 9:108146930-108146952 CTAAAATCAAGGTGTTGATAGGG - Intergenic
1059754410 9:117279010-117279032 CTCTATTAAAGGGGTTGAACTGG + Intronic
1059888857 9:118778608-118778630 CTAAAGTCAAGATGTTGACAGGG + Intergenic
1060789108 9:126473866-126473888 CCATACACAAGGTGGTGAACAGG - Intronic
1061759790 9:132842717-132842739 CTGCAGTCAAGGTGTTGACCAGG + Intronic
1186817598 X:13253175-13253197 CTGGAATCAAGGTGTTGAGCAGG - Intergenic
1186965709 X:14784287-14784309 CTACAGTCAAGGTGTTGGCAGGG + Intergenic
1187558802 X:20379565-20379587 CTAAAGTCAAGGTGTTGGCAGGG + Intergenic
1187634174 X:21208635-21208657 ATATATTCAAAGTGTTGAAGGGG + Intergenic
1188270009 X:28127690-28127712 CTAAAGTCAAGGTGTTGGCAGGG + Intergenic
1188773516 X:34184872-34184894 CTGTAGTCAAGGTGCTCACCAGG - Intergenic
1188996618 X:36894116-36894138 CTATAGTCAATCTGTTGTGCTGG - Intergenic
1189567768 X:42261156-42261178 CTAAAATCAAGGTGTTGGAAGGG - Intergenic
1189840883 X:45076175-45076197 GTATAGTCAAGGAGTTGCATAGG + Intronic
1190408022 X:50106871-50106893 CTGCAGTCAAGGTGTTGGTCAGG + Intergenic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1192977996 X:76306687-76306709 CTAGAGTCAAGGTCTGGAATTGG + Intergenic
1197332949 X:125177404-125177426 CTATAGTATAGATGTTGAGCTGG - Intergenic
1197704974 X:129628389-129628411 CTGCAGTCAAGGTGTTGGCCAGG + Intergenic
1198712045 X:139514989-139515011 CTAAAGTCAAGGTGTTGCCAGGG - Intergenic