ID: 981237851

View in Genome Browser
Species Human (GRCh38)
Location 4:142439009-142439031
Sequence CATCTGAGTGGTGCACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981237851_981237853 10 Left 981237851 4:142439009-142439031 CCATGGGGTGCACCACTCAGATG 0: 1
1: 0
2: 1
3: 6
4: 112
Right 981237853 4:142439042-142439064 AGACCTGCTGTGAGAAATACAGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981237851 Original CRISPR CATCTGAGTGGTGCACCCCA TGG (reversed) Intronic
901494474 1:9613376-9613398 GAACTGTGTGGGGCACCCCAGGG - Exonic
902278314 1:15355628-15355650 CAGCTCAGCGATGCACCCCAGGG - Intronic
902581879 1:17412988-17413010 CATCAGGGAGGGGCACCCCATGG + Intronic
903640252 1:24854688-24854710 CATCAGAGTGGGCCCCCCCATGG + Intergenic
908499547 1:64729572-64729594 CATCAGAGTGGCACACCACACGG + Intergenic
913711449 1:121488015-121488037 GATGTGACTGGTGGACCCCATGG - Intergenic
917200954 1:172514822-172514844 CATCTGGGTGGTGCACTTGATGG - Intergenic
920961146 1:210665125-210665147 CATGTGCATAGTGCACCCCATGG + Intronic
921358228 1:214306367-214306389 CATCTGACTGTAGCGCCCCAGGG + Intronic
923384128 1:233449646-233449668 CATGTGAGTGGCTCACCCTAAGG + Intergenic
1064262947 10:13800662-13800684 CATGTGAATGGTGACCCCCAGGG - Intronic
1064606809 10:17050518-17050540 CATCTGAGTAGGGCTTCCCATGG + Intronic
1069677616 10:70259954-70259976 CCTCTGGGTGCTTCACCCCAGGG - Intronic
1073071822 10:100799061-100799083 CCTCTGAGGGGTTCACCCCCAGG - Intronic
1073612277 10:104956375-104956397 CATCTCAGCTGTGCAACCCAAGG + Intronic
1077991636 11:7417374-7417396 CATCACAGTGTTGCACCCCAAGG + Intronic
1082233587 11:49798049-49798071 CATCTGGGAGGTGTACCCAACGG - Intergenic
1082923786 11:58524295-58524317 CTTCTCAGTGGTGCGCCCCTAGG + Intergenic
1082981615 11:59129088-59129110 CATCTGAATGCAGCTCCCCATGG + Intergenic
1083214285 11:61208720-61208742 CATTTGAGTTGTGCACATCAAGG - Intronic
1083217169 11:61227549-61227571 CATTTGAGTTGTGCACATCAAGG - Intronic
1083220051 11:61246375-61246397 CATTTGAGTTGTGCACATCAAGG - Intronic
1086505386 11:87498456-87498478 CATCTGGCAGGTGCACCTCAGGG + Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1092464389 12:8716649-8716671 CACCTGAGTGGGGCTTCCCATGG + Intronic
1094168537 12:27466815-27466837 CATTTGAGTGGTAAACACCAAGG - Exonic
1096240030 12:49954845-49954867 GATCTGAGGGGTGGAACCCAAGG - Intronic
1100028200 12:90153914-90153936 CATCAGGTTGGTGCACCTCAAGG + Intergenic
1100194868 12:92233957-92233979 AGTCTGAGTGGTGGAGCCCATGG + Intergenic
1100813807 12:98366180-98366202 CAGCTGATTGCTGTACCCCAGGG - Intergenic
1101897503 12:108767593-108767615 CAGCTGAGAGGTGTTCCCCAGGG + Intergenic
1104927026 12:132319103-132319125 CATGTGAGGTGTGCTCCCCATGG + Intronic
1105841637 13:24258987-24259009 CATATGGATGGTCCACCCCAAGG - Intronic
1112644718 13:101317418-101317440 CATCTGAAAAGTGCACACCAAGG + Intronic
1114621305 14:24098026-24098048 CATCTAAGGGGTGTTCCCCAAGG - Intronic
1120808237 14:88775728-88775750 CACCTGAGTGTAGAACCCCAGGG + Intronic
1121061389 14:90913283-90913305 CATCTGAGAGGTGCACACTCCGG + Intronic
1121777946 14:96603111-96603133 CATCTGAGAGGGGCACCGCCAGG + Intergenic
1125522824 15:40357758-40357780 CATCTAAGGGGTGCACACCCAGG + Intergenic
1127826623 15:62709380-62709402 CCTCTGCGTGGATCACCCCAGGG - Intronic
1128036178 15:64528690-64528712 CAACAGGGTGGTGCACCTCATGG - Intronic
1130105270 15:80924054-80924076 CAGCTGAGTGATGCTGCCCAGGG - Intronic
1130681543 15:86001376-86001398 AATCAGAGTGTTGCACCCCCTGG - Intergenic
1131064430 15:89424786-89424808 CATCTTAGGGGTGCACTGCAGGG - Intergenic
1132986008 16:2768022-2768044 CATCAGAGTGGGGCACCCCAGGG - Exonic
1133130659 16:3674470-3674492 CATCTGGATGATGGACCCCAAGG - Exonic
1135174093 16:20212768-20212790 CCCCTGTGTGTTGCACCCCATGG + Intergenic
1136573476 16:31109983-31110005 CAGCTGGGTGGTGATCCCCATGG + Intronic
1141883204 16:86873403-86873425 CATCTGAGCCATGTACCCCATGG + Intergenic
1153381707 18:4447583-4447605 CATCTGGGTGGTGGACACAAAGG + Intronic
1157348613 18:46863962-46863984 CATCTGAGACGTGCAAGCCAAGG + Intronic
1158334495 18:56400917-56400939 CATCTGGATGATGCATCCCACGG - Intergenic
1159207136 18:65267179-65267201 CATCTGAGTGGTGCCCCTGTGGG + Intergenic
1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG + Intronic
926726042 2:15998862-15998884 CATCTGAGCGGTGGAATCCAGGG + Intergenic
926954761 2:18282296-18282318 CTTCTGAGTGGAGCACCTGAGGG + Intronic
929891966 2:45925661-45925683 CATCCGAGTAGTGAACCCAAGGG + Intronic
932030565 2:68179444-68179466 CAACTGAGTGCTGCACATCATGG - Exonic
935099888 2:99983564-99983586 CATCTGAGGGGAGAACCTCAAGG + Intronic
936434003 2:112487611-112487633 ATTCTGAGTGGTGCTCTCCAAGG - Intronic
937507378 2:122552184-122552206 CATCTGATTGGTGTACCTGAAGG + Intergenic
937680781 2:124641926-124641948 CTTCTGAGTTGTGATCCCCATGG + Intronic
940410817 2:153360974-153360996 CATCAGATTGGTGCCCCTCAAGG + Intergenic
941088460 2:161146716-161146738 CATCTGGTTGGTGCCCCTCAAGG - Intronic
1169412697 20:5385967-5385989 CAACTTAATGATGCACCCCAAGG + Intergenic
1172884285 20:38221086-38221108 CATCTGACTGCAGCTCCCCACGG + Intronic
1172891371 20:38268218-38268240 GATCTGAGTGGTCCACTCCAAGG - Intronic
1174179834 20:48667879-48667901 CACTTGAGTGGAGGACCCCAAGG + Intronic
1175332738 20:58176272-58176294 CATCTGAGTGGGTCCCCCCAGGG - Intergenic
1175413265 20:58785248-58785270 CAGTTGAGTGGTGCACCCAGGGG + Intergenic
1178113386 21:29392713-29392735 CATCTGGGAGGTGTACCCAACGG - Intronic
1178173063 21:30063839-30063861 CATGTGAGTGCTGCAACTCAGGG - Intergenic
1178699040 21:34818202-34818224 CATGGGAGTGGAGCAGCCCAGGG - Intronic
1184370015 22:44076226-44076248 CAGCTGAGTCGTGGACTCCATGG + Intronic
1184690543 22:46115389-46115411 CATCACAGTGGAGCAGCCCAAGG + Intergenic
1184960167 22:47922918-47922940 CATCTGCATGGAGCACCCCAGGG - Intergenic
949846174 3:8372661-8372683 CATCTGAGAGGTGCCCCTCTGGG + Intergenic
950507199 3:13402546-13402568 CATCTCAGTGTGGCAGCCCAGGG - Intronic
953682225 3:45048289-45048311 GATCTGAGTGGTGCCCTCCATGG - Intergenic
955516171 3:59728735-59728757 CATCTGAGTTGTTCAACCCCTGG + Intergenic
955966145 3:64391171-64391193 CATCTGAGTGGTCCTCCCATTGG - Intronic
957529412 3:81421998-81422020 CATATGGGTGGTTAACCCCATGG - Intergenic
959449311 3:106480144-106480166 CAACTGTGTTGTGCTCCCCAGGG - Intergenic
962263295 3:133928363-133928385 CATCTGGGTGCTGGAACCCAAGG - Exonic
969695934 4:8734903-8734925 CATCGGAGTGGTGGAGGCCAGGG - Intergenic
971400660 4:26272727-26272749 AATATGGTTGGTGCACCCCAAGG - Intronic
973731586 4:53828256-53828278 CATCTGATTGGTGTACCTGAAGG - Intronic
980392847 4:132169292-132169314 CATCAGATTGGTGCCCCTCAAGG - Intergenic
981237851 4:142439009-142439031 CATCTGAGTGGTGCACCCCATGG - Intronic
982499131 4:156131355-156131377 CATCTGGGAGCTCCACCCCAGGG - Intergenic
983743853 4:171169606-171169628 CATCTCACTGGTGTACCCCACGG + Intergenic
988602726 5:32654804-32654826 CCTCTGTGTGTTGCAGCCCAGGG - Intergenic
989123190 5:38025247-38025269 AATCTGAGTGGCGCATCCCTAGG + Intergenic
990236940 5:53778706-53778728 CATCTGAGGGATCCACCCTAGGG + Intergenic
993191155 5:84683746-84683768 CATCTTAGTGCTGCACCCTCTGG + Intergenic
1002291331 5:178203034-178203056 CATATGGGTGGTGGGCCCCAAGG - Intergenic
1003713431 6:8619213-8619235 CATCTGGCAGGTGCCCCCCAGGG - Intergenic
1014114295 6:117655023-117655045 CATGTAAGTGGTACCCCCCAGGG + Intergenic
1014740985 6:125147427-125147449 CATCAGAGAGGTGCAGCACAAGG - Intronic
1016628604 6:146201033-146201055 GATCTGAGTGGTGCATTTCATGG + Intronic
1026777518 7:73239904-73239926 CATCTGATTGGTGGACCACCAGG + Intergenic
1027018372 7:74793276-74793298 CATCTGATTGGTGGACCACCAGG + Intergenic
1027069657 7:75152642-75152664 CATCTGATTGGTGGACCACCAGG - Intergenic
1027447339 7:78289468-78289490 CATCTGATTGGTGTACCTGAAGG + Intronic
1029812763 7:103065918-103065940 CATGTGTGTGGTGCACCCAGTGG - Intronic
1034344697 7:150379216-150379238 CATCTGAGCGGCGCAGCCAATGG + Intronic
1041669680 8:60479765-60479787 CATCTGACTAATGGACCCCAGGG - Intergenic
1042560629 8:70070424-70070446 CATCTGCGCGGTGCGACCCAGGG - Intronic
1046101473 8:109619100-109619122 CGTGTGTGTGGTGCACCGCATGG - Intronic
1048568081 8:135624916-135624938 CATCTGCATGGTGAGCCCCACGG + Intronic
1048626815 8:136194819-136194841 CATCTGATTGGTGTACCTGAAGG - Intergenic
1053071906 9:35106743-35106765 CATCCGAGTAGGGGACCCCAGGG - Intronic
1057704729 9:97388576-97388598 CATGTGAGTCCTGCACCACAGGG + Intergenic
1060399258 9:123338653-123338675 CATTTGAGTGGAGGCCCCCAGGG + Intergenic
1185629932 X:1508357-1508379 CATCTGGTGGGTGCAGCCCAGGG + Intronic
1192376591 X:70569030-70569052 CATCTGATTGGTGTACCTGAAGG - Intronic
1193768466 X:85560820-85560842 CATCAGGGTGGTGCCCCTCAAGG - Intergenic
1196603560 X:117629067-117629089 TATCTAAGTGGTGCATCCCTGGG - Intergenic
1197602062 X:128543025-128543047 CATCAGGGTGGTGCCCCTCAAGG - Intergenic
1199121673 X:144061417-144061439 CATATCAGGGGAGCACCCCATGG + Intergenic