ID: 981242670

View in Genome Browser
Species Human (GRCh38)
Location 4:142496721-142496743
Sequence CACATTATGTTTCCTATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981242670 Original CRISPR CACATTATGTTTCCTATAGC TGG (reversed) Intronic
910025098 1:82640529-82640551 CACATTATTTTGCATATAGAAGG + Intergenic
911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG + Intergenic
912469858 1:109899137-109899159 CAAATTCTGTTTCCTAGAGCCGG + Intergenic
913447091 1:118961105-118961127 CCCATCAGGTTTCCTATAGCAGG - Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
918194052 1:182205268-182205290 CACATTATATTTCCATTAGATGG - Intergenic
918231214 1:182534316-182534338 CACATTATTTTTCATTTACCAGG - Intronic
923453829 1:234144925-234144947 CACATGCTATTTCCTACAGCTGG - Intronic
923922863 1:238588457-238588479 CACATTATCTTTTCTATATTGGG + Intergenic
1063084039 10:2798664-2798686 CACATTAGATTACCTGTAGCTGG + Intergenic
1064458778 10:15513118-15513140 CTCAGTATGTTTCGTATACCTGG - Intergenic
1064722633 10:18245524-18245546 CTCACTATGTTTCCCACAGCTGG + Intronic
1065829215 10:29599151-29599173 AAAAAAATGTTTCCTATAGCAGG + Intronic
1066305495 10:34136526-34136548 TACACTATGCTTCCCATAGCAGG + Intronic
1067324842 10:45257654-45257676 CACAGTATTTTTCCTATATATGG + Intergenic
1067702887 10:48586478-48586500 CAGAATTTGTTTCCTAAAGCTGG + Intronic
1068106648 10:52626033-52626055 AACATTCTGTTTCCTAAAGTGGG + Intergenic
1068523872 10:58106274-58106296 CACATGATGTCTCCTATAATAGG - Intergenic
1072530972 10:96318762-96318784 CACAATGTGTTGACTATAGCAGG + Intronic
1075352125 10:121733538-121733560 CACATGGTGTTTTCTCTAGCAGG + Intergenic
1077455743 11:2678998-2679020 TAGATTATGTTTCTTATTGCGGG - Intronic
1078237250 11:9496929-9496951 CACATTCTGTTTATTTTAGCGGG + Intronic
1081129148 11:39355539-39355561 CGCATTCTGTTTGCTGTAGCGGG - Intergenic
1081819935 11:45982952-45982974 CACATTGTGTTTCCTAAGGATGG - Intronic
1083502141 11:63119292-63119314 CAAATTGTGTTTCCTCCAGCTGG - Exonic
1085103349 11:73820631-73820653 CACATGCTGTTTCCTCTACCTGG + Intronic
1085912870 11:80849296-80849318 CTCATTATGTTTCCCAAGGCTGG - Intergenic
1085956364 11:81401139-81401161 CACATTCTTTTTCCTTTATCTGG + Intergenic
1087406725 11:97740398-97740420 CACATTATGTCTCCTATTACAGG + Intergenic
1091685308 12:2557269-2557291 CACTTTATGTTTCTTTTAACTGG - Intronic
1092018449 12:5179832-5179854 AACAGTGTTTTTCCTATAGCAGG + Intergenic
1093511149 12:19929870-19929892 CACATTAGGATTCCAACAGCTGG - Intergenic
1093873606 12:24322254-24322276 CACATTTTGTTTCTCATTGCTGG + Intergenic
1095491678 12:42741221-42741243 GACAATATGTTTCACATAGCAGG - Intergenic
1095632420 12:44394061-44394083 CAAATTATGCTTCCTAGAACTGG - Intergenic
1098082293 12:66800530-66800552 TACATTATCTGTCTTATAGCTGG + Intronic
1098127626 12:67316950-67316972 CTCACTATGTTGCCTAGAGCTGG - Exonic
1105093878 13:16336481-16336503 AACATTACCTTTCCTAGAGCAGG + Intergenic
1105123473 13:16820009-16820031 AACATTACCTTTCCTAGAGCAGG + Intergenic
1105345443 13:19567032-19567054 CATATAATCTTTCCTCTAGCAGG + Intergenic
1108106985 13:47021208-47021230 CACATTCTGTTTCCAATAATGGG + Intergenic
1108646426 13:52433818-52433840 CACATTGTGTTTTCAATGGCGGG + Intronic
1112370960 13:98792971-98792993 CACATGATGGTTCCAATTGCAGG - Intergenic
1119372671 14:74161105-74161127 CACATTGTGTTTCATATATTTGG + Intronic
1121289654 14:92763554-92763576 CATATTATCTTTCCTATATAGGG + Intergenic
1123380989 15:19669422-19669444 CACATTCTGTTTCATACAGCAGG + Intergenic
1123787615 15:23688544-23688566 CACTTTATTTTTCCTCAAGCAGG + Intergenic
1126368677 15:47922687-47922709 CACAATCTGTTTCCTTTACCTGG - Intergenic
1127012324 15:54643936-54643958 CACCTCATCTTCCCTATAGCTGG - Intergenic
1127185724 15:56478420-56478442 CAGATTATGTTTGCTATTTCAGG - Intergenic
1128886653 15:71294353-71294375 CACATTTTGTTTGCTTTATCAGG - Intronic
1128974455 15:72139970-72139992 TTCATTATGATTCCCATAGCAGG + Exonic
1143317740 17:6045458-6045480 CATATGCTGTTTCCTATACCTGG - Intronic
1145262302 17:21361583-21361605 CACATGCTGTTTCCTCTACCTGG + Intergenic
1146095083 17:29922128-29922150 CACATGCTGTTTCCTTTACCTGG - Intronic
1147526489 17:41229253-41229275 GCCAATATGTCTCCTATAGCAGG - Intronic
1149120487 17:53157961-53157983 CTCATTATGTGTCTTATAACTGG + Intergenic
1153179099 18:2412875-2412897 CACATTATATTTACTATATATGG + Intergenic
1158176452 18:54662714-54662736 CAGATTAAATTTCATATAGCTGG - Intergenic
1167761673 19:51453868-51453890 CTCATTATTTTTCCTATTGGCGG - Intronic
929659145 2:43766141-43766163 CACATAATGATTCATAGAGCCGG - Exonic
929747946 2:44678585-44678607 CATATTTTTTTTCCTACAGCAGG + Intronic
930135815 2:47904435-47904457 AACATTATTTTTGCTAAAGCAGG + Intronic
932121646 2:69106388-69106410 CCCATTTTGTTTCCTATACTTGG - Intronic
933296079 2:80492738-80492760 CACATGCTGTTTCCTCTGGCTGG + Intronic
935731316 2:106066497-106066519 CAGATTATGGTTCCTAAAGTGGG - Intronic
936174606 2:110208814-110208836 CTCATTAGGTTTCCTTTACCAGG - Intergenic
940461796 2:153973675-153973697 CAAAGTATCTTTCATATAGCAGG + Intronic
940524047 2:154789440-154789462 CACAATATGTTTTCTAAAGAAGG - Intronic
940844629 2:158626265-158626287 CACATTGTGTTTTCTATTGATGG + Intronic
942938504 2:181588325-181588347 CACATGATCTTTCCTATATGTGG - Intronic
943577021 2:189641797-189641819 CTCATTATGTTTCCTCTTCCAGG - Intergenic
945299942 2:208206700-208206722 CACATTTTGCCACCTATAGCTGG + Intergenic
945325273 2:208474573-208474595 CATGTTATGTTTTCTATGGCTGG + Intronic
945773796 2:214079656-214079678 CACATTATCTTTCATCTTGCCGG - Intronic
1171170855 20:23014282-23014304 CACACACTGTTTCCTATACCTGG - Intergenic
1174423966 20:50419006-50419028 CACATGCTGTTCCCTATACCTGG - Intergenic
1174729225 20:52898450-52898472 CAGATTATGTTTTCTAAAGATGG - Intergenic
1175658363 20:60791640-60791662 GACATCATGTCTCCTTTAGCAGG + Intergenic
1183195018 22:36347535-36347557 CTCATTATGTTGCCTAGGGCTGG - Intronic
1202722386 2_KI270715v1_random:102199-102221 AACATTCTGTTTCATAGAGCAGG + Intergenic
1202722492 2_KI270715v1_random:103897-103919 AACATTCTGTTTCATAGAGCAGG + Intergenic
950630027 3:14276167-14276189 GACATACTGTTTCCTATAACCGG + Intergenic
952055416 3:29439047-29439069 CACACAATGTTTCCTTTACCTGG - Intronic
952500762 3:33959691-33959713 CACATGCTGTTTCCTACACCTGG - Intergenic
952827179 3:37533666-37533688 AACATTATTTGTCCTAGAGCTGG - Intronic
956970008 3:74511901-74511923 GACATGATCTTTCCTAAAGCTGG - Intronic
959466484 3:106693622-106693644 CATATTATTTTTCATATAGCTGG - Intergenic
960179915 3:114563816-114563838 CTTATTATTTTTCCTATAGCTGG + Intronic
963174302 3:142282011-142282033 AGCAATATGTTTCCTACAGCAGG + Intergenic
964695584 3:159504215-159504237 AACTTAATGTTTCCTATAACAGG - Intronic
964815071 3:160708346-160708368 TACATTGTGTTTCTTATACCGGG + Intergenic
967663583 3:192144528-192144550 TACATTATATTTCCTATGGTAGG - Intronic
968250286 3:197204131-197204153 CACATAATTTTTCCTATACATGG - Intronic
975974528 4:80079859-80079881 CAGATTATGTTGCCTATGGGGGG - Intronic
980642440 4:135597545-135597567 CGCAATATGTCTCCTATAGTAGG + Intergenic
981242670 4:142496721-142496743 CACATTATGTTTCCTATAGCTGG - Intronic
985284226 4:188318645-188318667 CACATTATTTTTCCTAAAAAAGG + Intergenic
986055607 5:4133850-4133872 CACATGATGTGTCCCATAGATGG - Intergenic
988185458 5:27855161-27855183 CTCACTATGTTTCCTAAGGCTGG - Intergenic
988185883 5:27861313-27861335 GACATTTTGTTTCCTGCAGCTGG + Intergenic
988277128 5:29096015-29096037 CACATTATGTTTCTAATAATTGG + Intergenic
989066432 5:37467309-37467331 CAAATTATGTTTCTTAAAGAGGG + Intronic
989446028 5:41529472-41529494 CACATTATGTCTCTTATATGTGG - Intergenic
989552613 5:42753523-42753545 CACATTAAGATTCATATAGGAGG - Intergenic
990465924 5:56071417-56071439 CACAATAGGTTTCCTGTAGTAGG + Intergenic
991737200 5:69638845-69638867 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991739637 5:69656877-69656899 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991788774 5:70218571-70218593 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991791212 5:70236618-70236640 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991813525 5:70493677-70493699 CAAATTATGTTTCTTAAAGAGGG - Intergenic
991816657 5:70514960-70514982 CAAATTATGTTTCTTAAAGAGGG - Intergenic
994699163 5:103111704-103111726 CACATTTTTTTTCCAATGGCTGG - Intronic
995537821 5:113154939-113154961 CACAGTAGGGTTACTATAGCTGG - Intronic
998050168 5:139025742-139025764 CACATGTTGTTTCCTCTAGCTGG + Intronic
998612177 5:143701374-143701396 CACATTGTGTTTGCTTTTGCAGG - Intergenic
1001774021 5:174315343-174315365 CACCTTCTGTTTCCTGTACCCGG - Intergenic
1006948182 6:37799579-37799601 CACATTCTGCTTCCTCGAGCTGG - Intergenic
1008950847 6:57157046-57157068 CACTGTATGTTACTTATAGCAGG - Intronic
1009853896 6:69234582-69234604 CTCATTATGTTACCTATATCTGG - Intronic
1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG + Intergenic
1015335098 6:132027821-132027843 CACATTATGTTCCTTGCAGCGGG + Intergenic
1020366608 7:7387151-7387173 CACATTCTGTTTCCTTTTGAAGG + Intronic
1021073271 7:16269877-16269899 AACATCATGTATCCTATAACTGG + Intronic
1021249282 7:18304485-18304507 CACATTACTTTACCTATAACAGG - Intronic
1022136832 7:27457169-27457191 CTCATTATGTTGCCTATACTAGG + Intergenic
1025247186 7:57326233-57326255 CACATGCTGTTCCCTATACCAGG + Intergenic
1026926308 7:74196280-74196302 CTCATTATGTTGCCTATACTAGG - Exonic
1029498604 7:100912918-100912940 AACATTATGTTTGCTAGACCTGG - Intergenic
1031497708 7:122471170-122471192 CACTTTATGTTTCTTTTTGCTGG - Intronic
1032706833 7:134427299-134427321 CAGATTATGTTTTCTAAAACTGG + Intergenic
1033580686 7:142731115-142731137 CAAATTCTGTTTCCTATAGCCGG - Intergenic
1035112510 7:156495035-156495057 CACCTTGTATTTCCTAGAGCAGG + Intergenic
1036428172 8:8665671-8665693 CACTTTATGTTCACTAAAGCAGG - Intergenic
1036968382 8:13326809-13326831 CAAAATATGATTCCTAGAGCCGG - Intronic
1037130486 8:15402856-15402878 CACAGCATCTTTCCTATTGCAGG + Intergenic
1037436542 8:18869602-18869624 CACATGCTGTTCCCTCTAGCTGG + Intronic
1043544477 8:81300124-81300146 CATAATACGTTTCCTATAACTGG - Intergenic
1044415691 8:91936698-91936720 CCCTTTGTGTTTCCTATAACTGG + Intergenic
1046099638 8:109599917-109599939 CACATGCTGTTCCCTCTAGCTGG + Intronic
1049905094 9:209155-209177 AACATTATGTCTCCTAGACCTGG - Intergenic
1052913424 9:33904939-33904961 CACATTTTGTTTCCTCCATCAGG - Intronic
1053939545 9:43219013-43219035 AACATTATCTTTCATAGAGCAGG + Intergenic
1054875759 9:70095067-70095089 CACATGCTGTTTCCTTTATCTGG - Intronic
1055103995 9:72493517-72493539 CCAAATATGTTTCCTATAGTTGG - Intergenic
1057402227 9:94734296-94734318 GACATTATACTTCCTATAACAGG - Intronic
1059640825 9:116214989-116215011 AACATTTTGTTTTCTATACCTGG - Intronic
1060200512 9:121649536-121649558 CCCATTTTGTTTCCCAAAGCAGG - Intronic
1187300942 X:18049255-18049277 CACTTTATGTTTCCTCTGCCTGG - Intergenic
1188811595 X:34658139-34658161 CACATCACTTTTCCTATTGCAGG - Intergenic
1190413626 X:50161092-50161114 AACATTTTTTTTCCTATGGCTGG - Intergenic
1192447106 X:71219362-71219384 CTCACTATGTTGCCTATGGCTGG + Intronic
1193000104 X:76554190-76554212 AGCAATATGTCTCCTATAGCAGG - Intergenic
1193518739 X:82503136-82503158 CACCTTATGTTACCAATAGAAGG - Intergenic
1194972195 X:100356385-100356407 CACATAACCTTTCCTAAAGCTGG + Intronic
1195728476 X:107941076-107941098 CACATGCTGTTTCCTCTACCTGG - Intergenic
1197112540 X:122793655-122793677 CACTTCATGATTGCTATAGCAGG - Intergenic