ID: 981244408

View in Genome Browser
Species Human (GRCh38)
Location 4:142517110-142517132
Sequence CCTGGTATGCAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 567}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981244408_981244417 10 Left 981244408 4:142517110-142517132 CCTTCCACCCTCTGCATACCAGG 0: 1
1: 0
2: 2
3: 44
4: 567
Right 981244417 4:142517143-142517165 AAATTCTACAGCAGTCAAAAAGG 0: 1
1: 0
2: 1
3: 37
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981244408 Original CRISPR CCTGGTATGCAGAGGGTGGA AGG (reversed) Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902241635 1:15094087-15094109 CCCGGGAGGCAGAGGGTGGTGGG - Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
904585916 1:31580517-31580539 CCTGGTGTGCAGAGAGGGAAAGG + Intronic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905757932 1:40527493-40527515 CCTGTTATGGAGTGGGGGGAAGG + Intergenic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
911609544 1:99945529-99945551 CCTGGAATGCCAAGGTTGGAGGG + Intergenic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
912177014 1:107171724-107171746 GCAGGTTTTCAGAGGGTGGATGG - Intronic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
912965865 1:114236882-114236904 CCTGGGAGGCAGAGGTTGAAGGG + Intergenic
912968629 1:114259707-114259729 CCTTGTATGCAGGGTGTGAAGGG - Intergenic
913285628 1:117224059-117224081 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915732461 1:158063735-158063757 CCTGGTAAGCAGAGAGAGAAGGG - Intronic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
918812280 1:189137820-189137842 CCTGTTATGGGGTGGGTGGAGGG + Intergenic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919221643 1:194638277-194638299 CCTGGAAGGCGGAGGGTGGGAGG - Intergenic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920531035 1:206702752-206702774 CCTGGAAGGCAAAGTGTGGAAGG - Intronic
921649832 1:217664363-217664385 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
922147909 1:222966956-222966978 CCTGGTATGGAGTGGGAGGGAGG + Intronic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1062938322 10:1404008-1404030 CCTGGCTTGCTGAGAGTGGATGG - Intronic
1063308804 10:4933611-4933633 CCTGGTAGGCAGTGGGTGCCTGG - Intronic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067053963 10:43040689-43040711 CCTGCTATGCTGTGGGGGGAGGG + Intergenic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1068703159 10:60041831-60041853 ACTGGTATGCAGAGTGCTGAGGG - Intronic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070260372 10:74849055-74849077 CCTGGGATGCTGAGGTTGCAGGG - Intronic
1070430453 10:76332643-76332665 CCTAGAATGTACAGGGTGGAAGG + Intronic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074780430 10:116798291-116798313 CTTGGTTTGCCCAGGGTGGAGGG + Intergenic
1074873164 10:117593786-117593808 GCTGGTATATAGAAGGTGGATGG + Intergenic
1075064417 10:119279880-119279902 CCTGGTTTGCACATGCTGGAGGG + Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1078758848 11:14235569-14235591 TTTGGTATGCTGAGGGTAGAAGG + Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079505954 11:21152156-21152178 AATGGAATGCAGGGGGTGGAGGG + Intronic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081675332 11:44965274-44965296 CCTGGTATGAGGAGGGAGGCTGG + Intergenic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1083876485 11:65526690-65526712 CCTGGCATGCAGTGGGTGCCTGG + Intronic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1084979374 11:72821220-72821242 CCTGGTGTGGTGAGGATGGAAGG + Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088618707 11:111660264-111660286 CCTTGTATCTGGAGGGTGGAAGG + Intronic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091574451 12:1720334-1720356 ACTGGTGGGCAGGGGGTGGAGGG + Intronic
1092926160 12:13274440-13274462 CCTGGAATGCACCGGGAGGATGG + Intergenic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1094142745 12:27198037-27198059 CCAGGATTGCAGAGGGTGGGAGG - Intergenic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097890993 12:64777833-64777855 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1098966626 12:76797185-76797207 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102203052 12:111070775-111070797 ACTGGTGTCCAGAGGTTGGAGGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1104932882 12:132348996-132349018 CCTGGAATGCAGCGGGCAGAGGG + Intergenic
1104982334 12:132579056-132579078 CCAGGTATCCAGAGGAGGGAAGG - Intronic
1105510544 13:21048500-21048522 TATGGTAGGTAGAGGGTGGATGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107480430 13:40781484-40781506 CCAGGTCTGCAGTGGGTGTAGGG + Intergenic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107524072 13:41213236-41213258 CCTGGTATACAGAGGGACTAGGG + Intergenic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1110870930 13:80451970-80451992 CCTGGGTCCCAGAGGGTGGAGGG - Intergenic
1111535736 13:89600179-89600201 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112746369 13:102531647-102531669 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1113958844 13:114114387-114114409 CCTGGCACGCAGAGGGGTGAAGG + Intronic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1116203863 14:41835616-41835638 CCTGGGATGCTGAGGTGGGAGGG + Intronic
1116951571 14:50883107-50883129 CCAGGTATGCAGAAGATGGCAGG + Intronic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1119855699 14:77898966-77898988 CCTGGAATTCAGAGGAGGGATGG + Intronic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122395343 14:101424540-101424562 CCTGGATTGCAAAGGATGGAGGG - Intergenic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122865554 14:104602446-104602468 TCTGGGAAGCTGAGGGTGGAGGG - Intronic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127569111 15:60223583-60223605 CCCAGAATGCAGAGGGTTGAGGG - Intergenic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1130001471 15:80050971-80050993 CCTGGGAGGCTGAGGTTGGAGGG + Intergenic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131340524 15:91596476-91596498 ACTGGTGTTCTGAGGGTGGAGGG + Intergenic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133336580 16:5010565-5010587 CCCGGTGGGGAGAGGGTGGAGGG + Intronic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135916309 16:26608362-26608384 GGTGGTATCCAGAGAGTGGAAGG + Intergenic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1139592744 16:67942582-67942604 GCTGGCCTGCAGCGGGTGGAAGG + Exonic
1139601496 16:67990189-67990211 CCAGGGATCCAGAGGGTGGCAGG - Intronic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1140755238 16:78060637-78060659 CCTGGGAGGCAGAGGTTGTATGG - Intronic
1141586870 16:85039908-85039930 CCTGGGAGGCGGAGGGTGTAGGG - Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142073403 16:88103647-88103669 CCTGGGATGCCGAGGCTGGGTGG + Intronic
1142340140 16:89516473-89516495 CCTGGTAGGCAGAGGTTGCAGGG + Intronic
1142644829 17:1304917-1304939 CCTGGTGTGCTGAGGGTAGTTGG + Intergenic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143482785 17:7237208-7237230 GCTGGTATGCGGGGAGTGGATGG - Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148150046 17:45391530-45391552 GCTGGTATGCATAGGTGGGAGGG + Intergenic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1148926384 17:51089749-51089771 TCTGGTAGGCAGAGGTTGCAGGG - Intronic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1152196768 17:78923251-78923273 CCAGGATGGCAGAGGGTGGAGGG - Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1152608379 17:81304034-81304056 CCTGGCATGCAGAGAGAGAAGGG - Intergenic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154111219 18:11570148-11570170 CTTGGTGTGCAGAGGGGGAATGG - Intergenic
1154378307 18:13827011-13827033 CCTGCTAGGTGGAGGGTGGATGG - Intergenic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155308094 18:24498668-24498690 CTTGGCCTGCCGAGGGTGGAGGG + Intergenic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157182469 18:45509930-45509952 TCTGTTAGGCAGAGGATGGATGG - Intronic
1157232223 18:45928118-45928140 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158140443 18:54249977-54249999 CCAAGTATGCAGAATGTGGAAGG - Intergenic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1159945129 18:74438988-74439010 CCAGGAATGTAGAGGGTGGAAGG - Intronic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160924804 19:1538819-1538841 CCTGGCATGGAGTGGGTGAAGGG + Intergenic
1161150878 19:2708323-2708345 ACTGGTTTTCAGTGGGTGGATGG - Intergenic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1163559502 19:18010374-18010396 GCTTGCATGCAGAGGGTGGGTGG + Intronic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1163666482 19:18606244-18606266 CCTGGCATGCAGAGGGTCTCAGG + Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165367521 19:35377650-35377672 CCTGGTAAGCAGAGGTTGTGAGG + Intergenic
1165485295 19:36091804-36091826 CCTGGTAGGTAGAGGTTGCAGGG + Intronic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1166205399 19:41265585-41265607 CCTGGTGTCCAGAGGCTGGCGGG + Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168121458 19:54254517-54254539 CCTGGGATGCAAATGGTGAAAGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925752510 2:7102254-7102276 CCTGGGAGGCAGAGGTTGTAGGG - Intergenic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
926091869 2:10056364-10056386 CCTGGGAGGCGGAGGGTGCAGGG + Intergenic
926413054 2:12625019-12625041 CCTGTTTTGAAGAGGGTGGTAGG + Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928944419 2:36760068-36760090 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
929109419 2:38393925-38393947 CCTGGGAGGCTGAGGGTGGGTGG + Intergenic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930237392 2:48900998-48901020 CCTGGTATTCAGAGTCTGTAGGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931151192 2:59575337-59575359 CCTGCTATATAGAGGGTAGATGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935301119 2:101694877-101694899 TCTGGTATGCAGAGGAGGAAAGG + Intergenic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
936473155 2:112816493-112816515 CCTGGTATTCAGAGGGATTAGGG + Intergenic
936959775 2:118061010-118061032 ACTGGTATTCAGCAGGTGGATGG + Intergenic
938541978 2:132290661-132290683 CCCGGGAGGCAGAGGTTGGAGGG + Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942575562 2:177360019-177360041 ACTGGTATGGTGAGGGTGGTTGG - Intronic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944743285 2:202633277-202633299 CCCGGGAGGCAGAGGTTGGAAGG - Intergenic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
946800424 2:223409740-223409762 CCTGGTATTTACAGGGTGGTGGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947680834 2:232031327-232031349 CCAGGTATTCATAGGGTGTAGGG + Intronic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
949046475 2:241874697-241874719 CCCGGTAAGCAGAGGGTGCCGGG - Intergenic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1170269990 20:14515683-14515705 ACTGGTTAGCAGAGGCTGGATGG + Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1172049142 20:32103060-32103082 ACTGGTATCCAGATGCTGGATGG + Intergenic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1174313387 20:49677326-49677348 GATGGTGTGCAGAGGGTGGTTGG - Intronic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1177454323 21:21316617-21316639 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
1177894971 21:26846427-26846449 CCTGGTAGGAAGAGGAAGGAGGG - Intergenic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1179289435 21:40005910-40005932 GCTGGGATCCAGAGTGTGGATGG + Intergenic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181568089 22:23751683-23751705 CCTGGGATGCAGAGAGTTGGGGG - Intergenic
1181741682 22:24926119-24926141 CCTGGTGTGCTCAGGGTGGGAGG - Intronic
1182453261 22:30433595-30433617 CCTGGAAGGCACAGGTTGGAAGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
950156651 3:10726082-10726104 CCTGGGATACAGAGGGTTGGGGG - Intergenic
950681111 3:14585716-14585738 CCTGGTATGCAGTGGGTGCTTGG - Intergenic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951202298 3:19889119-19889141 CCTGGTAAGTAGGGGGAGGAGGG + Intronic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952534323 3:34294340-34294362 CTTGGTATGTGGATGGTGGATGG + Intergenic
953705641 3:45227816-45227838 CCTGATATGCAAAGGTTGAAAGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954630108 3:52043513-52043535 CCTGGAGTGCACAGGCTGGAGGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954745648 3:52786109-52786131 CCTGGCTTGCAGAGGGTGCTTGG + Intronic
954980026 3:54737512-54737534 CCTGGGAAGAAGAGGGTGGTTGG + Intronic
955320949 3:57973811-57973833 CTTGGGATGCAGGGGGTGGGAGG + Intergenic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
956048073 3:65217822-65217844 CCTGTTGTGGAGTGGGTGGAAGG - Intergenic
957274758 3:78076535-78076557 CCTGGTTTGCAGAGGTTGGGAGG + Intergenic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
960144255 3:114182685-114182707 CCTGGTAGGCTGAGGTTGCAGGG - Intronic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960846045 3:122005385-122005407 CCTGGTATGCTGAGGAGAGAGGG + Exonic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
961777720 3:129301483-129301505 CCTGGTACCCAGAGGATGTAAGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964433795 3:156631668-156631690 CCTGGTATAGGGTGGGTGGAGGG + Intergenic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
965758685 3:172052191-172052213 CGTGGGAGGCTGAGGGTGGAAGG - Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
966732216 3:183160893-183160915 CCTGGCATGCAGAGAGTGCCAGG + Intronic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968654585 4:1773033-1773055 CCAGGTTTGCAGCGGGTGGGGGG - Intergenic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969842563 4:9893225-9893247 CCAGGAATGCGGAGGGGGGAGGG - Intronic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
972466883 4:39366144-39366166 CCTGGTATGCAGGGTGGGGGAGG - Intronic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
975831442 4:78373230-78373252 TATGGTATACAGAGGGTTGAAGG - Intronic
976274413 4:83261531-83261553 ACTGGCACCCAGAGGGTGGAGGG + Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982252068 4:153417211-153417233 CCTGGGATGCAGAGGTTGCGTGG + Intergenic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
986303876 5:6501211-6501233 AGTGGAATGCAGAGGATGGACGG + Intergenic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
988312883 5:29584067-29584089 CCTGGTAGGCGGAGGTTGCAGGG + Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
993104855 5:83588605-83588627 CCTGGTATGCGAAGGCTGGCTGG + Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
996523533 5:124452762-124452784 CCTGGTTTGCAGAGTGCAGAGGG + Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997411678 5:133695768-133695790 CCTGGTTTGCAGGGAGGGGAGGG - Intergenic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997555281 5:134792099-134792121 CCTGGGAGGCACAGGGTGTAGGG + Intronic
997601519 5:135141768-135141790 CCTGGGATGCTGAGGGTGTCAGG + Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998757651 5:145398486-145398508 ACTGGTATGCAGAGGGTTTAGGG - Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999762873 5:154716193-154716215 CCCGGGAGGCAGAGGGTGCAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004468050 6:15904029-15904051 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006626203 6:35399718-35399740 CCCTGTATGAAGAGGGTGGTAGG - Intronic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1008063234 6:47020418-47020440 CCCGGTAGGCAGAGGTTGCAGGG + Intronic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1012671322 6:102051308-102051330 CCTAGCTTGCAGAGAGTGGAAGG - Intronic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013485896 6:110595658-110595680 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1021160853 7:17271438-17271460 CCGGGTATGCATAGGGTTGGTGG + Intergenic
1021403597 7:20238069-20238091 CCTGGTCTGAAAAGGGAGGAGGG + Intergenic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1023217052 7:37873908-37873930 CCAAGTATGCAGTTGGTGGAAGG - Intronic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024929480 7:54655081-54655103 CCTGGTATGCGGAGTGTTGATGG - Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026303551 7:69120163-69120185 TCTGGGAAGCAGAGGTTGGAGGG + Intergenic
1026772563 7:73211678-73211700 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027013427 7:74765078-74765100 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027074611 7:75180955-75180977 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1030219983 7:107088377-107088399 CCTGGGAAGTACAGGGTGGAGGG + Intronic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036552695 8:9828976-9828998 CCAGGTGTGCACAGGGTGGTGGG + Intergenic
1036962959 8:13265852-13265874 TCGGGTATGCACAGGGTGGTTGG + Intronic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038250847 8:25902962-25902984 CCTGGTAGGCAGAGGCTGAGTGG + Intronic
1039194066 8:35010560-35010582 CATGGTAGGCAGAGGTTGCAGGG + Intergenic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039390752 8:37179300-37179322 CGTGGTAAGCAGAGGCTGGTTGG - Intergenic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1049555191 8:143278101-143278123 CATGGTCTGGAGAGGGTGGCGGG - Intergenic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050995924 9:12217651-12217673 CCCGGGAGGCAGAGGGTGCAGGG - Intergenic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1061183774 9:129040254-129040276 CCTGGTAGGCAGAGGGTCTGTGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1061859638 9:133461245-133461267 CCAGGTGGGTAGAGGGTGGAGGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1189349181 X:40264201-40264223 CATGGTCTGCAGAGACTGGAAGG + Intergenic
1189980637 X:46506826-46506848 CCAGCAATGCAGAGGGTGAAGGG + Intronic
1190190049 X:48269448-48269470 CCTGGTAGGCAGAGGTTGCAGGG - Intronic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1197800251 X:130340260-130340282 CCTGCTACCCAGAGGGTGAATGG + Exonic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1198777368 X:140194488-140194510 GCTGGTCTGATGAGGGTGGATGG + Intergenic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic