ID: 981246427

View in Genome Browser
Species Human (GRCh38)
Location 4:142545331-142545353
Sequence TGCAATTAACCCTATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981246425_981246427 26 Left 981246425 4:142545282-142545304 CCAAACACTGACTATTGTGAGTA 0: 1
1: 0
2: 1
3: 22
4: 283
Right 981246427 4:142545331-142545353 TGCAATTAACCCTATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981246427 Original CRISPR TGCAATTAACCCTATGAGGT AGG Intronic
No off target data available for this crispr